Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T46360 Target Info
Target Name Opioid receptor sigma 1 (OPRS1)
Synonyms hSigmaR1; Sigma1R; Sigma1-receptor; Sigma non-opioid intracellular receptor 1; Sigma 1-type opioid receptor; SRBP; SR31747-binding protein; SR31747 binding protein 1; SR-BP; SIG-1R; Opioid receptor, sigma 1, isoform 1; OPRS1 protein; Aging-associated gene 8 protein; AAG8
Target Type Successful Target
Gene Name SIGMAR1
Biochemical Class GPCR rhodopsin
UniProt ID
Q99720
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-205-5p miRNA Info
miRNA Mature AC
MIMAT0000266
Sequence uccuucauuccaccggagucug
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Androgen receptor (AR) Target Info
ANDR_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
References  Top
REF 1 MiR-205 silences MED1 in hypoxic primary human trophoblasts. FASEB J. 2010 Jun;24(6):2030-9.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.