Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T46628 Target Info
Target Name Microsomal triglyceride transfer protein (MTTP)
Synonyms Microsomal triglyceride transfer protein large subunit; MTP
Target Type Successful Target
Gene Name MTTP
UniProt ID
P55157
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-30e-5p miRNA Info
miRNA Mature AC
MIMAT0000692
Sequence uguaaacauccuugacuggaag
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Caspase-3 (CASP3) Target Info
CASP3_HUMAN
Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
References  Top
REF 1 MiR-132, miR-15a and miR-16 synergistically inhibit pituitary tumor cell proliferation, invasion and migration by targeting Sox5. Cancer Lett. 2015 Jan 28;356(2 Pt B):568-78.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.