Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T50942 Target Info
Target Name Low-affinity nerve growth factor receptor (NGFR)
Synonyms p75 ICD; Tumor necrosis factor receptor superfamily member 16; TNFRSF16; P75neurotrophin receptor (p75(NTR)); P75NTR; P75ICD; NGFreceptor; NGF-P75 receptor; NGF receptor; Lowaffinity neurotrophin receptor p75NTR; Low affinity neurotrophin receptor p75NTR; Gp80-LNGFR; CD271; 75kD-neurotrophin receptor
Target Type Successful Target
Gene Name NGFR
Biochemical Class Cytokine receptor
UniProt ID
P08138
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-296-5p miRNA Info
miRNA Mature AC
MIMAT0000690
Sequence agggcccccccucaauccugu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Immunoprecipitation; Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Bcl-2-binding component 3 (BBC3) Target Info
BBC3_HUMAN
References  Top
REF 1 MicroRNA-296-5p Promotes Invasiveness through Downregulation of Nerve Growth Factor Receptor and Caspase-8. Mol Cells. 2017 Apr;40(4):254-261.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.