miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-296-5p | ||||
| miRNA Stemloop AC | MI0000747 | ||||
| miRNA Stemloop ID | hsa-mir-296 | ||||
| Sequence | agggcccccccucaauccugu | ||||
| TTD Target(s) Regulated by This miRNA | Fibroblast growth factor receptor 1 (FGFR1) | Successful Target | Target Info | [1] | |
| Vascular endothelial growth factor receptor 2 (KDR) | Successful Target | Target Info | [2] | ||
| Multidrug resistance protein 1 (ABCB1) | Clinical trial Target | Target Info | [3] | ||
| Apoptosis regulator Bcl-2 (BCL-2) | Successful Target | Target Info | [4] | ||
| Low-affinity nerve growth factor receptor (NGFR) | Successful Target | Target Info | [5] | ||
| Vascular endothelial growth factor A (VEGFA) | Successful Target | Target Info | [2] | ||
| Polo-like kinase 1 (PLK1) | Clinical trial Target | Target Info | [6] | ||
| Rotamase Pin1 (PIN1) | Clinical trial Target | Target Info | [7] | ||
| G1/S-specific cyclin-D1 (CCND1) | Clinical trial Target | Target Info | [8] | ||
| Notch-1 receptor (NOTCH1) | Clinical trial Target | Target Info | [2] | ||
| Delta-like protein 4 (DLL4) | Clinical trial Target | Target Info | [2] | ||
| S100 calcium-binding protein B (S100B) | Clinical trial Target | Target Info | [9] | ||
| Caspase-8 (CASP8) | Patented-recorded Target | Target Info | [5] | ||
| Bcl-2-binding component 3 (BBC3) | Literature-reported Target | Target Info | [10] | ||
| CDK inhibitor 1B p27Kip1 (CDKN1B) | Literature-reported Target | Target Info | [11] | ||
| ELAV-like protein 1 (ELAVL1) | Literature-reported Target | Target Info | [12] | ||
| High mobility group protein HMG-I/Y (HMGA1) | Literature-reported Target | Target Info | [13] | ||
| Inhibitor of nuclear factor kappa-B kinase (IKK) | Patented-recorded Target | Target Info | [14] | ||
| Protein(s) Regulated by This miRNA | Hepatocyte growth factor-regulated tyrosine kinase substrate | Regulated Protein | [15] | ||
| Homeobox protein CDX-1 | Regulated Protein | [16] | |||
| Protein scribble homolog | Regulated Protein | [17] | |||
| Serine/threonine-protein kinase WNK4 | Regulated Protein | [18] | |||
| References | |||||
| REF 1 | miR-296 inhibits proliferation and induces apoptosis by targeting FGFR1 in human hepatocellular carcinoma. FEBS Lett. 2016 Dec;590(23):4252-4262. | ||||
| REF 2 | Prongiogenic microRNA 96 upregulatesvascular endothelial growth factor and downregulates Notch1 following cerebral ischemic injury. Mol Med Rep. 2015 Dec;12(6):8141-7. | ||||
| REF 3 | Involvement of microRNA-451 in resistance of the MCF-7 breast cancer cells to chemotherapeutic drug doxorubicin. Mol Cancer Ther. 2008 Jul;7(7):2152-9. | ||||
| REF 4 | miR-15 and miR-16 induce apoptosis by targeting BCL2. Proc Natl Acad Sci U S A. 2005 Sep 27;102(39):13944-9. | ||||
| REF 5 | MicroRNA-296-5p Promotes Invasiveness through Downregulation of Nerve Growth Factor Receptor and Caspase-8. Mol Cells. 2017 Apr;40(4):254-261. | ||||
| REF 6 | miR-296-5p suppresses cell viability by directly targeting PLK1 in non-small cell lung cancer. Oncol Rep. 2016 Jan;35(1):497-503. | ||||
| REF 7 | MicroRNA-296-5p (miR-296-5p) functions as a tumor suppressor in prostate cancer by directly targeting Pin1. Biochim Biophys Acta. 2014 Sep;1843(9):2055-66. | ||||
| REF 8 | MicroRNA let-7b targets important cell cycle molecules in malignant melanoma cells and interferes with anchorage-independent growth. Cell Res. 2008 May;18(5):549-57. | ||||
| REF 9 | Deregulated miR-296/S100A4 axis promotes tumor invasion by inducing epithelial-mesenchymal transition in human ovarian cancer. Am J Cancer Res. 2016 Jan 15;6(2):260-9. | ||||
| REF 10 | A role for miR-296 in the regulation of lipoapoptosis by targeting PUMA. J Lipid Res. 2011 Aug;52(8):1517-25. | ||||
| REF 11 | miR-221 and miR-222 expression affects the proliferation potential of human prostate carcinoma cell lines by targeting p27Kip1. J Biol Chem. 2007 Aug 10;282(32):23716-24. | ||||
| REF 12 | MicroRNA-9 inhibits hyperglycemia-induced pyroptosis in human ventricular cardiomyocytes by targeting ELAVL1. Biochem Biophys Res Commun. 2016 Mar 18;471(4):423-9. | ||||
| REF 13 | Epigenetic modulation of a miR-296-5p:HMGA1 axis regulates Sox2 expression and glioblastoma stem cells. Oncogene. 2016 Sep 15;35(37):4903-13. | ||||
| REF 14 | Epstein-Barr virus-induced miR-155 attenuates NF-kappaB signaling and stabilizes latent virus persistence. J Virol. 2008 Nov;82(21):10436-43. | ||||
| REF 15 | miR-296 regulates growth factor receptor overexpression in angiogenic endothelial cells.Cancer Cell. 2008 Nov 4;14(5):382-93. | ||||
| REF 16 | MicroRNA-296-5p increases proliferation in gastric cancer through repression of Caudal-related homeobox 1.Oncogene. 2014 Feb 6;33(6):783-93. | ||||
| REF 17 | miR-296 regulation of a cell polarity-cell plasticity module controls tumor progression.Oncogene. 2012 Jan 5;31(1):27-38. | ||||
| REF 18 | Human with-no-lysine kinase-4 3'-UTR acting as the enhancer and being targeted by miR-296.Int J Biochem Cell Biol. 2010 Sep;42(9):1536-43. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.