Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T51191 Target Info
Target Name Histone deacetylase 2 (HDAC2)
Synonyms HD2
Target Type Clinical trial Target
Gene Name HDAC2
Biochemical Class Carbon-nitrogen hydrolase
UniProt ID
Q92769
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-145-5p miRNA Info
miRNA Mature AC
MIMAT0000437
Sequence guccaguuuucccaggaaucccu
miRNA Species Homo sapiens
Regulation Mechanism miR-145 is an endogenous regulator of HDAC2 expression in HCC. [1]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [1]
2 Western Blot? [2]
Representative Target(s) Regulated by This miRNA A proliferation-inducing ligand (APRIL) Target Info
TNF13_HUMAN
Alkaline phosphatase (ALPPL2) Target Info
PPBN_HUMAN
miRNA Mature ID hsa-miR-455-3p miRNA Info
miRNA Mature AC
MIMAT0004784
Sequence gcaguccaugggcauauacac
miRNA Species Homo sapiens
Regulation Mechanism miR-455-3p does indeed modulate HDAC2 expression by binding to the 3'UTR of the respective sequences. [3]
Evidence Score (E-score) 1 +
1 Immunoprecipitation; Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA Eukaryotic initiation factor 4E (EIF4E) Target Info
IF4E_HUMAN
Histone deacetylase 2 (HDAC2) Target Info
HDAC2_HUMAN
References  Top
REF 1 MiR-145 functions as a tumor suppressor by directly targeting histone deacetylase 2 in liver cancer. Cancer Lett. 2013 Jul 28;335(2):455-62.
REF 2 FKBP3 Promotes Proliferation of Non-Small Cell Lung Cancer Cells through Regulating Sp1/HDAC2/p27. Theranostics. 2017 Jul 22;7(12):3078-3089.
REF 3 MicroRNA-455-3p modulates cartilage development and degeneration through modification of histone H3 acetylation. Biochim Biophys Acta. 2016 Dec;1863(12):2881-2891.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.