Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T51817 Target Info
Target Name GATA-binding factor 4 (GATA4)
Synonyms Transcription factor GATA-4; GATA-4; GATA binding factor-4
Target Type Literature-reported Target
Gene Name GATA4
Biochemical Class Zinc-finger
UniProt ID
P43694
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-200b-3p miRNA Info
miRNA Mature AC
MIMAT0000318
Sequence uaauacugccugguaaugauga
miRNA Species Homo sapiens
Regulation Mechanism GATA-4 is a novel direct target of miR-200b. [2]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [1]
2 Western Blot [2]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
CDK inhibitor 1B p27Kip1 (CDKN1B) Target Info
CDN1B_HUMAN
miRNA Mature ID hsa-miR-200c-3p miRNA Info
miRNA Mature AC
MIMAT0000617
Sequence uaauacugccggguaaugaugga
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-26b-5p miRNA Info
miRNA Mature AC
MIMAT0000083
Sequence uucaaguaauucaggauaggu
miRNA Species Homo sapiens
Regulation Mechanism miR-26b might target and depress GATA4 expression. [4]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Northern Blot; Western Blot [4]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
Collagen I (COL1A2) Target Info
CO1A2_HUMAN
References  Top
REF 1 BMP4 depletion by miR-200 inhibits tumorigenesis and metastasis of lung adenocarcinoma cells. Mol Cancer. 2015 Sep 22;14:173.
REF 2 miR-200b targets GATA-4 during cell growth and differentiation. RNA Biol. 2013 Apr;10(4):465-80.
REF 3 miR-200c and GATA binding protein 4 regulate human embryonic stem cell renewal and differentiation. Stem Cell Res. 2014 Mar;12(2):338-53.
REF 4 GATA4 expression is primarily regulated via a miR-26b-dependent post-transcriptional mechanism during cardiac hypertrophy. Cardiovasc Res. 2012 Mar 15;93(4):645-54.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.