miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-26b-5p | ||||
| miRNA Stemloop AC | MI0000084 | ||||
| miRNA Stemloop ID | hsa-mir-26b | ||||
| Sequence | uucaaguaauucaggauaggu | ||||
| TTD Target(s) Regulated by This miRNA | Cyclin-dependent kinase 6 (CDK6) | Successful Target | Target Info | [1] | |
| Insulin-like growth factor I receptor (IGF1R) | Successful Target | Target Info | [2] | ||
| Phosphodiesterase 4A (PDE4A) | Successful Target | Target Info | [3] | ||
| ATP-binding cassette transporter A1 (ABCA1) | Successful Target | Target Info | [4] | ||
| Prostaglandin G/H synthase 2 (COX-2) | Successful Target | Target Info | [5] | ||
| Enhancer of zeste homolog 2 (EZH2) | Successful Target | Target Info | [6] | ||
| Hepatocyte growth factor (HGF) | Clinical trial Target | Target Info | [7] | ||
| Nicotinamide phosphoribosyltransferase (NAMPT) | Clinical trial Target | Target Info | [8] | ||
| Toll-like receptor 4 (TLR4) | Clinical trial Target | Target Info | [9] | ||
| Ephrin type-A receptor 2 (EPHA2) | Clinical trial Target | Target Info | [10] | ||
| Collagen I (COL1A2) | Clinical trial Target | Target Info | [11] | ||
| Connective tissue growth factor (CTGF) | Clinical trial Target | Target Info | [11] | ||
| Insulin-like growth factor-I (IGF1) | Clinical trial Target | Target Info | [12] | ||
| Phosphatase and tensin homolog (PTEN) | Literature-reported Target | Target Info | [13] | ||
| G1/S-specific cyclin-E1 (CCNE1) | Literature-reported Target | Target Info | [1] | ||
| Sialyltransferase 8D (ST8SIA4) | Literature-reported Target | Target Info | [14] | ||
| GATA-binding factor 4 (GATA4) | Literature-reported Target | Target Info | [15] | ||
| Protein(s) Regulated by This miRNA | ADP-ribosylation factor-like protein 4C | Regulated Protein | [16] | ||
| Cysteine and histidine-rich domain-containing protein 1 | Regulated Protein | [17] | |||
| Fumarate hydratase, mitochondrial | Regulated Protein | [18] | |||
| Hyaluronan synthase 2 | Regulated Protein | [19] | |||
| Importin subunit alpha-1 | Regulated Protein | [20] | |||
| La-related protein 1 | Regulated Protein | [21] | |||
| Migration and invasion enhancer 1 | Regulated Protein | [22] | |||
| Nuclear receptor subfamily 2 group C member 2 | Regulated Protein | [23] | |||
| Probable ubiquitin carboxyl-terminal hydrolase FAF-X | Regulated Protein | [24] | |||
| Procollagen-lysine,2-oxoglutarate 5-dioxygenase 2 | Regulated Protein | [25] | |||
| Prostaglandin G/H synthase 2 | Regulated Protein | [26] | |||
| Protein jagged-1 | Regulated Protein | [27] | |||
| Retinoblastoma-associated protein | Regulated Protein | [28] | |||
| Serine/threonine-protein kinase ULK2 | Regulated Protein | [29] | |||
| TGF-beta-activated kinase 1 and MAP3K7-binding protein 1 | Regulated Protein | [23] | |||
| TNF receptor-associated factor 5 | Regulated Protein | [30] | |||
| References | |||||
| REF 1 | MicroRNA-26a/b and their host genes cooperate to inhibit the G1/S transition by activating the pRb protein. Nucleic Acids Res. 2012 May;40(10):4615-25. | ||||
| REF 2 | Modulation of microRNAs in hypertension-induced arterial remodeling through the 1 and 3-adrenoreceptor pathways. J Mol Cell Cardiol. 2013 Dec;65:127-36. | ||||
| REF 3 | Comparative effects of diet and carcinogen on microRNA expression in the stem cell niche of the mouse colonic crypt. Biochim Biophys Acta. 2016 Jan;1862(1):121-34. | ||||
| REF 4 | MicroRNA target prediction by expression analysis of host genes. Genome Res. 2009 Mar;19(3):481-90. | ||||
| REF 5 | MiRNA-26b regulates the expression of cyclooxygenase-2 in desferrioxamine-treated CNE cells. FEBS Lett. 2010 Mar 5;584(5):961-7. | ||||
| REF 6 | Huaier suppresses proliferation and induces apoptosis in human pulmonary cancer cells via upregulation of miR-26b-5p. FEBS Lett. 2014 Jun 5;588(12):2107-14. | ||||
| REF 7 | Exosome-delivered EGFR regulates liver microenvironment to promote gastric cancer liver metastasis. Nat Commun. 2017 Apr 10;8:15016. | ||||
| REF 8 | Nicotinamide phosphoribosyl transferase (Nampt) is a target of microRNA-26b in colorectal cancer cells. PLoS One. 2013 Jul 29;8(7):e69963. | ||||
| REF 9 | Respiratory syncytial virus infection inhibits TLR4 signaling via up-regulation of miR-26b. Cell Biol Int. 2015 Dec;39(12):1376-83. | ||||
| REF 10 | MiR-26b inhibits hepatocellular carcinoma cell proliferation, migration, and invasion by targeting EphA2. Int J Clin Exp Pathol. 2015 May 1;8(5):4782-90. | ||||
| REF 11 | CircRNA_000203 enhances the expression of fibrosis-associated genes by derepressing targets of miR-26b-5p, Col1a2 and CTGF, in cardiac fibroblasts. Sci Rep. 2017 Jan 12;7:40342. | ||||
| REF 12 | MicroRNA-26b is upregulated in a double transgenic mouse model of Alzheimer's disease and promotes the expression of amyloid- by targeting insulin-like growth factor 1. Mol Med Rep. 2016 Mar;13(3):2809-14. | ||||
| REF 13 | The role of microRNA-26b in human adipocyte differentiation and proliferation. Gene. 2014 Jan 10;533(2):481-7. | ||||
| REF 14 | Functional roles of sialylation in breast cancer progression through miR-26a/26b targeting ST8SIA4. Cell Death Dis. 2016 Dec 29;7(12):e2561. | ||||
| REF 15 | GATA4 expression is primarily regulated via a miR-26b-dependent post-transcriptional mechanism during cardiac hypertrophy. Cardiovasc Res. 2012 Mar 15;93(4):645-54. | ||||
| REF 16 | MiR-26 controls LXR-dependent cholesterol efflux by targeting ABCA1 and ARL7. FEBS Lett. 2012 May 21;586(10):1472-9. | ||||
| REF 17 | MicroRNA-26b inhibits hepatitis B virus transcription and replication by targeting the host factor CHORDC1 protein.J Biol Chem. 2014 Dec 12;289(50):35029-41. | ||||
| REF 18 | Mcl-1 Is a Novel Target of miR-26b That Is Associated with the Apoptosis Induced by TRAIL in HCC Cells.Biomed Res Int. 2015;2015:572738. | ||||
| REF 19 | Conserved miR-26b enhances ovarian granulosa cell apoptosis through HAS2-HA-CD44-Caspase-3 pathway by targeting HAS2.Sci Rep. 2016 Feb 18;6:21197. | ||||
| REF 20 | MiR-26b/KPNA2 axis inhibits epithelial ovarian carcinoma proliferation and metastasis through downregulating OCT4.Oncotarget. 2015 Sep 15;6(27):23793-806. | ||||
| REF 21 | MicroRNA-26a/b directly regulate La-related protein 1 and inhibit cancer cell invasion in prostate cancer.Int J Oncol. 2015 Aug;47(2):710-8. | ||||
| REF 22 | MicroRNA-26b suppresses the metastasis of non-small cell lung cancer by targeting MIEN1 via NF-B/MMP-9/VEGF pathways.Biochem Biophys Res Commun. 2016 Apr 8;472(3):465-70. | ||||
| REF 23 | MicroRNA-26b suppresses the NF-B signaling and enhances the chemosensitivity of hepatocellular carcinoma cells by targeting TAK1 and TAB3.Mol Cancer. 2014 Feb 24;13:35. | ||||
| REF 24 | MicroRNA-26b inhibits epithelial-mesenchymal transition in hepatocellular carcinoma by targeting USP9X.BMC Cancer. 2014 Jun 2;14:393. | ||||
| REF 25 | Tumour-suppressive miRNA-26a-5p and miR-26b-5p inhibit cell aggressiveness by regulating PLOD2 in bladder cancer.Br J Cancer. 2016 Jul 26;115(3):354-63. | ||||
| REF 26 | miR-26b is downregulated in human tongue squamous cell carcinoma and regulates cell proliferation and metastasis through a COX-2-dependent mechanism.Oncol Rep. 2015 Feb;33(2):974-80. | ||||
| REF 27 | Down-regulation of miR-26b induces cisplatin resistance in nasopharyngeal carcinoma by repressing JAG1.FEBS Open Bio. 2016 Oct 24;6(12):1211-1219. | ||||
| REF 28 | MiR-26b, upregulated in Alzheimer's disease, activates cell cycle entry, tau-phosphorylation, and apoptosis in postmitotic neurons.J Neurosci. 2013 Sep 11;33(37):14645-59. | ||||
| REF 29 | MiR-26b inhibits autophagy by targeting ULK2 in prostate cancer cells.Biochem Biophys Res Commun. 2016 Mar 25;472(1):194-200. | ||||
| REF 30 | MiR-26b inhibits melanoma cell proliferation and enhances apoptosis by suppressing TRAF5-mediated MAPK activation.Biochem Biophys Res Commun. 2016 Mar 11;471(3):361-7. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.