Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T56871 Target Info
Target Name Lysine-specific demethylase 5B (KDM5B)
Synonyms Retinoblastomabinding protein 2 homolog 1; Retinoblastoma-binding protein 2 homolog 1; RBP2H1; RBP2-H1; RBBP2H1; PLU1; PLU-1; Lysinespecific demethylase 5B; Jumonji/ARID domaincontaining protein 1B; Jumonji/ARID domain-containing protein 1B; JARID1B; Histone demethylase JARID1B; Cancer/testis antigen 31; CT31
Target Type Literature-reported Target
Gene Name KDM5B
Biochemical Class Paired donor oxygen oxidoreductase
UniProt ID
Q9UGL1
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-29a-3p miRNA Info
miRNA Mature AC
MIMAT0000086
Sequence uagcaccaucugaaaucgguua
miRNA Species Homo sapiens
Regulation Mechanism miR-29a directly interacts with KDM5B. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Aryl hydrocarbon receptor (AHR) Target Info
AHR_HUMAN
miRNA Mature ID hsa-miR-424-5p miRNA Info
miRNA Mature AC
MIMAT0001341
Sequence cagcagcaauucauguuuugaa
miRNA Species Homo sapiens
Regulation Mechanism KDM5B was identified as a direct target of miR424-5p as the evidence that miR-424-5p inhibited KDM5B expression and luciferase activity of KDM5B 3'UTR. [2]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Checkpoint kinase-1 (CHK1) Target Info
CHK1_HUMAN
Cyclin D (CCND3) Target Info
CCND3_HUMAN
References  Top
REF 1 MiR-29a suppresses prostate cell proliferation and induces apoptosis via KDM5B protein regulation. Int J Clin Exp Med. 2015 Apr 15;8(4):5329-39.
REF 2 miR424-5p functions as an anti-oncogene in cervical cancer cell growth by targeting KDM5B via the Notch signaling pathway. Life Sci. 2017 Feb 15;171:9-15.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.