Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T58238 |
Target Info
|
| Target Name |
Activation B7-1 antigen (CD80) |
| Synonyms |
T-lymphocyte activation antigen CD80; LAB7; CTLA-4 counter-receptor B7.1; CD28LG1; CD28LG; BB1; B7 |
| Target Type |
Successful Target |
| Gene Name |
CD80 |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-146a-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
ugagaacugaauuccauggguu
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
CD80 total protein levels were reducedan average of 60% in the miR-146a mimic transfected THP-1cells compared with non-targeting control miRNA transfected cells. |
[2] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot |
[1] |
| 2 |
Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot |
[2] |
| Representative Target(s) Regulated by This miRNA |
Activation B7-1 antigen (CD80)
|
Target Info
|
|
|
Apoptosis mediating surface antigen FAS (FAS)
|
Target Info
|
|
| References |
Top |
| REF 1 |
Dysregulated co-stimulatory molecule expression in a Sjren's syndrome mouse model with potential implications by microRNA-146a. Mol Immunol. 2015 Dec;68(2 Pt C):606-16.
|
| REF 2 |
miR-146a is differentially expressed by myeloid dendritic cell subsets and desensitizes cells to TLR2-dependent activation. J Immunol. 2010 May 1;184(9):4955-65.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
