Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T58674 Target Info
Target Name APJ endogenous ligand (Apelin)
Synonyms Apelin13; APEL
Target Type Literature-reported Target
Gene Name APLN
UniProt ID
Q9ULZ1
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-224-5p miRNA Info
miRNA Mature AC
MIMAT0000281
Sequence ucaagucacuagugguuccguuuag
miRNA Species Homo sapiens
Regulation Mechanism Fragment at the 3'UTR of the APLN mRNA was the complementary site for the miR-224 seed region and, therefore, that APLN was a direct target of miR-224. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA APJ endogenous ligand (Apelin) Target Info
APEL_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
References  Top
REF 1 Dysregulated microRNA-224/apelin axis associated with aggressive progression and poor prognosis in patients with prostate cancer. Hum Pathol. 2015 Feb;46(2):295-303.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.