Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T59654 Target Info
Target Name Polo-like kinase 2 (PLK2)
Synonyms hSNK; hPlk2; Serum-inducible kinase; Serine/threonine-protein kinase SNK; Serine/threonine-protein kinase PLK2; SNK; PLK-2
Target Type Patented-recorded Target
Gene Name PLK2
Biochemical Class Kinase
UniProt ID
Q9NYY3
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-126-3p miRNA Info
miRNA Mature AC
MIMAT0000445
Sequence ucguaccgugaguaauaaugcg
miRNA Species Homo sapiens
Regulation Mechanism A significantly negative effect on luciferase activity was observed in the presence of miR-126 on the 3'UTR of PLK2 and such repression disappeared when the predicted target site in the 3'UTR of PLK2 was mutated. [1]
Evidence Score (E-score) 2 +
Representative Target(s) Regulated by This miRNA Adrenomedullin (ADM) Target Info
ADML_HUMAN
Angiopoietin 1 receptor (TEK) Target Info
TIE2_HUMAN
miRNA Mature ID hsa-miR-27b-3p miRNA Info
miRNA Mature AC
MIMAT0000419
Sequence uucacaguggcuaaguucugc
miRNA Species Homo sapiens
Regulation Mechanism miR-27b downregulates the expression of PLK2. [3]
Evidence Score (E-score) 1 +
Representative Target(s) Regulated by This miRNA Adenosine A2b receptor (ADORA2B) Target Info
AA2BR_HUMAN
Albendazole monooxygenase (CYP3A4) Target Info
CP3A4_HUMAN
References  Top
REF 1 Distinct microRNA expression profiles in acute myeloid leukemia with common translocations. Proc Natl Acad Sci U S A. 2008 Oct 7;105(40):15535-40.
REF 2 Mir-126 inhibits growth of SGC-7901 cells by synergistically targeting the oncogenes PI3KR2 and Crk, and the tumor suppressor PLK2. Int J Oncol. 2014 Sep;45(3):1257-65.
REF 3 MicroRNA-27b up-regulated by human papillomavirus 16 E7 promotes proliferation and suppresses apoptosis by targeting polo-like kinase2 in cervical cancer. Oncotarget. 2016 Apr 12;7(15):19666-79.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.