Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T59875 Target Info
Target Name Estrogen-related receptor-gamma (ESRRG)
Synonyms Nuclear receptor subfamily 3 group B member 3; NR3B3; KIAA0832; Estrogen-related receptor gamma; Estrogen receptor-related protein 3; ERRG2; ERR3; ERR gamma-2
Target Type Literature-reported Target
Gene Name ESRRG
Biochemical Class Nuclear hormone receptor
UniProt ID
P62508
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-205-5p miRNA Info
miRNA Mature AC
MIMAT0000266
Sequence uccuucauuccaccggagucug
miRNA Species Homo sapiens
Regulation Mechanism miR-205 acts as an oncomiR through targeting ESRRG. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Androgen receptor (AR) Target Info
ANDR_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
References  Top
REF 1 miR-205 promotes tumor proliferation and invasion through targeting ESRRG in endometrial carcinoma. Oncol Rep. 2013 Jun;29(6):2297-302.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.