Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T61744 Target Info
Target Name Phosphodiesterase 4A (PDE4A)
Synonyms cAMP-specific 3',5'-cyclic phosphodiesterase 4A; Type 4A cAMP phosphodiesterase; PDE46; DPDE2
Target Type Successful Target
Gene Name PDE4A
Biochemical Class Phosphoric diester hydrolase
UniProt ID
P27815
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-26b-5p miRNA Info
miRNA Mature AC
MIMAT0000083
Sequence uucaaguaauucaggauaggu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
Collagen I (COL1A2) Target Info
CO1A2_HUMAN
References  Top
REF 1 Comparative effects of diet and carcinogen on microRNA expression in the stem cell niche of the mouse colonic crypt. Biochim Biophys Acta. 2016 Jan;1862(1):121-34.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.