Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T61792 |
Target Info
|
| Target Name |
Multidrug resistance-associated protein 2 (ABCC2) |
| Synonyms |
MRP2; Canalicular multispecific organic anion transporter 1; Canalicular multidrug resistance protein; CMRP; CMOAT1; CMOAT; ATP-binding cassette, sub-family C, member 2; ATP-binding cassette sub-family C member 2 |
| Target Type |
Literature-reported Target |
| Gene Name |
ABCC2 |
| Biochemical Class |
ABC transporter |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-490-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
caaccuggaggacuccaugcug
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
ABCC2 was a direct target of miR-490-3p and miR-490-3p downregulated ABCC2 expression via binding to its 3'UTR. |
[1] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Luciferase Reporter Assay; Western Blot |
[1] |
| Representative Target(s) Regulated by This miRNA |
G1/S-specific cyclin-D1 (CCND1)
|
Target Info
|
|
|
High mobility group protein HMGI-C (HMGA2)
|
Target Info
|
|
| References |
Top |
| REF 1 |
MiR-490-3p sensitizes ovarian cancer cells to cisplatin by directly targeting ABCC2. Am J Transl Res. 2017 Mar 15;9(3):1127-1138.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
