Content Navigation
( All
None )
Target General Information |
Top |
Target ID |
T61909 |
Target Info
|
Target Name |
Disheveled-associated activator of morphogenesis 2 (DAAM2) |
Synonyms |
KIAA0381; Disheveledassociated activator of morphogenesis 2 |
Target Type |
Literature-reported Target |
Gene Name |
DAAM2 |
UniProt ID |
|
The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-335-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ucaagagcaauaacgaaaaaugu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
DAAM2 is a direct target of miR-335. |
[1] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; qRT-PCR; Western Blot |
[1] |
Representative Target(s) Regulated by This miRNA |
Apoptosis inhibitor survivin (BIRC5)
|
Target Info
|
|
Apoptosis regulator Bcl-W (BCL-W)
|
Target Info
|
|
References |
Top |
REF 1 |
Metastasis suppressor microRNA-335 targets the formin family of actin nucleators. PLoS One. 2013 Nov 5;8(11):e78428.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.