Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T70234 |
Target Info
|
| Target Name |
Ephrin type-A receptor 4 (EPHA4) |
| Synonyms |
hEK8; Tyrosineprotein kinase receptor SEK; Tyrosineprotein kinase TYRO1; Tyrosine-protein kinase receptor SEK; Tyrosine-protein kinase TYRO1; TYRO1; SEK; Ephrin typeA receptor 4; EPHlike kinase 8; EPH-like kinase 8; EK8 |
| Target Type |
Literature-reported Target |
| Gene Name |
EPHA4 |
| Biochemical Class |
Kinase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-10a-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uacccuguagauccgaauuugug
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-10a targets the 3'UTR of the EphA4 transcript and down-regulates its expression. |
[1] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
GFP Reporter Assay; Western Blot |
[1] |
| 2 |
Western Blot |
[2] |
| Representative Target(s) Regulated by This miRNA |
AN1-type zinc finger protein 5 (ZFAND5)
|
Target Info
|
|
|
Brain-derived neurotrophic factor (BDNF)
|
Target Info
|
|
| References |
Top |
| REF 1 |
MicroRNA-10a is involved in the metastatic process by regulating Eph tyrosine kinase receptor A4-mediated epithelial-mesenchymal transition and adhesion in hepatoma cells. Hepatology. 2013 Feb;57(2):667-77.
|
| REF 2 |
Exosomal MicroRNA-10a Is Associated with Liver Regeneration in Rats through Downregulation of EphA4. Chin Med J (Engl). 2018 Feb 20;131(4):454-460.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
