Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T72038 |
Target Info
|
| Target Name |
Galectin-3 (LGALS3) |
| Synonyms |
Mac-2 antigen; MAC2; Lectin L-29; Laminin-binding protein; L-31; IgE-binding protein; Galactoside-binding protein; Galactose-specific lectin 3; Gal-3; GALBP; Carbohydrate-binding protein 35; Carbohydrate binding protein 35; CBP 35; Beta-galactoside-binding protein LGALS3; 35 kDa lectin |
| Target Type |
Clinical trial Target |
| Gene Name |
LGALS3 |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-424-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
caaaacgugaggcgcugcuau
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
The downregulation of miR-424-3p by 2'-O-Me Antisense miRNA Oligonucleotides resulted in the increased protein level of target LGALS3. |
[1] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Northern Blot; qRT-PCR; Western Blot |
[1] |
| 2 |
RT-PCR |
[2] |
| Representative Target(s) Regulated by This miRNA |
Galectin-3 (LGALS3)
|
Target Info
|
|
|
Yes-associated protein 1 (YAP1)
|
Target Info
|
|
| References |
Top |
| REF 1 |
The MUC1 and galectin-3 oncoproteins function in a microRNA-dependent regulatory loop. Mol Cell. 2007 Sep 21;27(6):992-1004.
|
| REF 2 |
MiR-424-3p suppresses galectin-3 expression and sensitizes ovarian cancer cells to cisplatin. Arch Gynecol Obstet. 2019 Apr;299(4):1077-1087.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
