Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T72120 |
Target Info
|
| Target Name |
Utrophin (UTRN) |
| Synonyms |
Dystrophin-related protein 1; DRP1; DRP-1; DMDL |
| Target Type |
Clinical trial Target |
| Gene Name |
UTRN |
| Biochemical Class |
Zinc-finger |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-206 |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uggaauguaaggaagugugugg
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
PAR-CLIP |
[1] |
| 2 |
Reporter Assay |
[2] |
| Representative Target(s) Regulated by This miRNA |
Annexin A2 (ANXA2)
|
Target Info
|
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
| References |
Top |
| REF 1 |
In-depth analysis of the interaction of HIV-1 with cellular microRNA biogenesis and effector mechanisms. MBio. 2013 Apr 16;4(2):e000193.
|
| REF 2 |
MyoD inhibits Fstl1 and Utrn expression by inducing transcription of miR-206. J Cell Biol. 2006 Oct 9;175(1):77-85.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
