miRNA Details
miRNA General Information | |||||
---|---|---|---|---|---|
miRNA Mature ID | hsa-miR-206 | ||||
miRNA Stemloop AC | MI0000490 | ||||
miRNA Stemloop ID | hsa-mir-206 | ||||
Sequence | uggaauguaaggaagugugugg | ||||
TTD Target(s) Regulated by This miRNA | Estrogen receptor (ESR) | Successful Target | Target Info | [1] | |
Cyclin-dependent kinase 4 (CDK4) | Successful Target | Target Info | [2] | ||
Glucose-6-phosphate dehydrogenase (G6PD) | Successful Target | Target Info | [3] | ||
Insulin-like growth factor I receptor (IGF1R) | Successful Target | Target Info | [4] | ||
Proto-oncogene c-Met (MET) | Successful Target | Target Info | [5] | ||
Apoptosis regulator Bcl-2 (BCL-2) | Successful Target | Target Info | [4] | ||
Phosphogluconate dehydrogenase (PGD) | Successful Target | Target Info | [3] | ||
Neuropilin-1 (NRP1) | Successful Target | Target Info | [6] | ||
Vascular endothelial growth factor A (VEGFA) | Successful Target | Target Info | [7] | ||
RAC-alpha serine/threonine-protein kinase (AKT1) | Clinical trial Target | Target Info | [8] | ||
Histone deacetylase 4 (HDAC4) | Clinical trial Target | Target Info | [4] | ||
Monocyte chemotactic and activating factor (CCL2) | Clinical trial Target | Target Info | [7] | ||
Superoxide dismutase Cu-Zn (SOD Cu-Zn) | Clinical trial Target | Target Info | [9] | ||
G1/S-specific cyclin-D1 (CCND1) | Clinical trial Target | Target Info | [10] | ||
Utrophin (UTRN) | Clinical trial Target | Target Info | [11] | ||
Brain-derived neurotrophic factor (BDNF) | Clinical trial Target | Target Info | [4] | ||
Gap junction alpha-1 protein (GJA1) | Clinical trial Target | Target Info | [12] | ||
Notch-3 receptor (NOTCH3) | Clinical trial Target | Target Info | [13] | ||
Kruppel like factor 4 (KLF4) | Clinical trial Target | Target Info | [4] | ||
Oxysterols receptor LXR-alpha (NR1H3) | Patented-recorded Target | Target Info | [14] | ||
Transketolase (TK) | Literature-reported Target | Target Info | [3] | ||
Annexin A2 (ANXA2) | Literature-reported Target | Target Info | [15] | ||
Orphan nuclear receptor NURR1 (NR4A2) | Literature-reported Target | Target Info | [16] | ||
Stanniocalcin-2 (STC2) | Literature-reported Target | Target Info | [4] | ||
Protein(s) Regulated by This miRNA | Actin-like protein 6A | Regulated Protein | [17] | ||
Fibroblast growth factor receptor substrate 2 | Regulated Protein | [4] | |||
Follistatin-related protein 1 | Regulated Protein | [19] | |||
G1/S-specific cyclin-D2 | Regulated Protein | [20] | |||
Glycerol-3-phosphate dehydrogenase, mitochondrial | Regulated Protein | [3] | |||
Homeobox protein OTX2 | Regulated Protein | [22] | |||
Mothers against decapentaplegic homolog 2 | Regulated Protein | [6] | |||
Paired box protein Pax-3 | Regulated Protein | [24] | |||
Protachykinin-1 | Regulated Protein | [25] | |||
Secreted frizzled-related protein 1 | Regulated Protein | [4] | |||
SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily B member 1 | Regulated Protein | [26] | |||
T-box transcription factor TBX3 | Regulated Protein | [27] | |||
Transcription factor SOX-9 | Regulated Protein | [28] | |||
Twinfilin-1 | Regulated Protein | [29] | |||
Twist-related protein 1 | Regulated Protein | [30] | |||
Vesicle-associated membrane protein 2 | Regulated Protein | [31] | |||
References | |||||
REF 1 | The micro-ribonucleic acid (miRNA) miR-206 targets the human estrogen receptor-alpha (ERalpha) and represses ERalpha messenger RNA and protein expression in breast cancer cell lines. Mol Endocrinol. 2007 May;21(5):1132-47. | ||||
REF 2 | MicroRNA-206 induces G1 arrest in melanoma by inhibition of CDK4 and Cyclin D. Pigment Cell Melanoma Res. 2014 Mar;27(2):275-86. | ||||
REF 3 | Transcription factor NRF2 regulates miR-1 and miR-206 to drive tumorigenesis. J Clin Invest. 2013 Jul;123(7):2921-34. | ||||
REF 4 | MicroRNA-206 suppresses gastric cancer cell growth and metastasis. Cell Biosci. 2014 May 5;4:26. | ||||
REF 5 | Down-regulation of micro-RNA-1 (miR-1) in lung cancer. Suppression of tumorigenic property of lung cancer cells and their sensitization to doxorubicin-induced apoptosis by miR-1. J Biol Chem. 2008 Nov 28;283(48):33394-405. | ||||
REF 6 | MiR-206 suppresses epithelial mesenchymal transition by targeting TGF- signaling in estrogen receptor positive breast cancer cells. Oncotarget. 2016 Apr 26;7(17):24537-48. | ||||
REF 7 | A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64. | ||||
REF 8 | Skeletal Muscle myomiR Are Differentially Expressed by Endurance Exercise Mode and Combined Essential Amino Acid and Carbohydrate Supplementation. Front Physiol. 2017 Mar 23;8:182. | ||||
REF 9 | MicroRNA profiling of atrial fibrillation in canines: miR-206 modulates intrinsic cardiac autonomic nerve remodeling by regulating SOD1. PLoS One. 2015 Mar 27;10(3):e0122674. | ||||
REF 10 | Cyclin D1 is a major target of miR-206 in cell differentiation and transformation. Cell Cycle. 2013 Dec 15;12(24):3781-90. | ||||
REF 11 | In-depth analysis of the interaction of HIV-1 with cellular microRNA biogenesis and effector mechanisms. MBio. 2013 Apr 16;4(2):e000193. | ||||
REF 12 | MIR-206 regulates connexin43 expression during skeletal muscle development. Nucleic Acids Res. 2006;34(20):5863-71. | ||||
REF 13 | MicroRNA-206 targets notch3, activates apoptosis, and inhibits tumor cell migration and focus formation. J Biol Chem. 2009 Nov 13;284(46):31921-7. | ||||
REF 14 | miR-206 controls LXR expression and promotes LXR-mediated cholesterol efflux in macrophages. Biochim Biophys Acta. 2014 Jun;1841(6):827-35. | ||||
REF 15 | MicroRNA-206 functions as a pleiotropic modulator of cell proliferation, invasion and lymphangiogenesis in pancreatic adenocarcinoma by targeting ANXA2 and KRAS genes. Oncogene. 2015 Sep 10;34(37):4867-78. | ||||
REF 16 | miR-206 modulates lipopolysaccharide-mediated inflammatory cytokine production in human astrocytes. Cell Signal. 2015 Jan;27(1):61-8. | ||||
REF 17 | Failure to downregulate the BAF53a subunit of the SWI/SNF chromatin remodeling complex contributes to the differentiation block in rhabdomyosarcoma.Oncogene. 2014 May 1;33(18):2354-62. | ||||
REF 18 | MicroRNA-206 suppresses gastric cancer cell growth and metastasis. Cell Biosci. 2014 May 5;4:26. | ||||
REF 19 | MyoD inhibits Fstl1 and Utrn expression by inducing transcription of miR-206. J Cell Biol. 2006 Oct 9;175(1):77-85. | ||||
REF 20 | miR-206 inhibits gastric cancer proliferation in part by repressing cyclinD2.Cancer Lett. 2013 May 10;332(1):94-101. | ||||
REF 21 | Transcription factor NRF2 regulates miR-1 and miR-206 to drive tumorigenesis. J Clin Invest. 2013 Jul;123(7):2921-34. | ||||
REF 22 | MiR-206, a Cerebellum Enriched miRNA Is Downregulated in All Medulloblastoma Subgroups and Its Overexpression Is Necessary for Growth Inhibition of Medulloblastoma Cells.J Mol Neurosci. 2015 Jul;56(3):673-80. | ||||
REF 23 | MiR-206 suppresses epithelial mesenchymal transition by targeting TGF- signaling in estrogen receptor positive breast cancer cells. Oncotarget. 2016 Apr 26;7(17):24537-48. | ||||
REF 24 | MyoD regulates apoptosis of myoblasts through microRNA-mediated down-regulation of Pax3.J Cell Biol. 2010 Oct 18;191(2):347-65. | ||||
REF 25 | MicroRNAs regulate synthesis of the neurotransmitter substance P in human mesenchymal stem cell-derived neuronal cells.Proc Natl Acad Sci U S A. 2007 Sep 25;104(39):15484-9. | ||||
REF 26 | SMARCB1 expression in epithelioid sarcoma is regulated by miR-206, miR-381, and miR-671-5p on Both mRNA and protein levels.Genes Chromosomes Cancer. 2014 Feb;53(2):168-76. | ||||
REF 27 | Regulation of the T-box transcription factor Tbx3 by the tumour suppressor microRNA-206 in breast cancer.Br J Cancer. 2016 May 10;114(10):1125-34. | ||||
REF 28 | miR-206 inhibits non small cell lung cancer cell proliferation and invasion by targeting SOX9. Int J Clin Exp Med. 2015 Jun 15;8(6):9107-13. | ||||
REF 29 | miR-206 Inhibits Stemness and Metastasis of Breast Cancer by Targeting MKL1/IL11 Pathway.Clin Cancer Res. 2017 Feb 15;23(4):1091-1103. | ||||
REF 30 | MyoD transcription factor induces myogenesis by inhibiting Twist-1 through miR-206.J Cell Sci. 2015 Oct 1;128(19):3631-45. | ||||
REF 31 | MicroRNA-206 regulates surfactant secretion by targeting VAMP-2.FEBS Lett. 2015 Jan 2;589(1):172-6. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.