Target Regulator(s) Information (MicroRNA)
Target General Information | Top | ||||
---|---|---|---|---|---|
Target ID | T73977 | Target Info | |||
Target Name | Voltage-gated calcium channel alpha Cav2.3 (CACNA1E) | ||||
Synonyms | Voltage-gated calcium channel subunit alpha Cav2.3; Voltage-gated calcium channel alpha subunit Cav2.3; Voltage-dependent R-type calcium channel subunit alpha-1E; Voltage-dependent R-type calcium channel; R-type voltage-gated calcium channel; Class E voltage-gated calcium channel; Calcium channel, Ltype, alpha-1 polypeptide, isoform 6; Calcium channel, L type, alpha-1 polypeptide, isoform 6; CACNL1A6; CACH6; Brain calcium channel II; BII | ||||
Target Type | Literature-reported Target | ||||
Gene Name | CACNA1E | ||||
Biochemical Class | Voltage-gated ion channel | ||||
UniProt ID |
The microRNAs (miRNAs) Regulating This Target | Top | ||||
---|---|---|---|---|---|
miRNA Mature ID | hsa-miR-541-3p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | uggugggcacagaaucuggacu | ||||
miRNA Species | Homo sapiens | ||||
Evidence Score (E-score) | 1 | + | |||
Representative Target(s) Regulated by This miRNA | Erbb2 tyrosine kinase receptor (HER2) | Target Info | |||
Voltage-gated calcium channel alpha Cav2.3 (CACNA1E) | Target Info |
References | Top | ||||
---|---|---|---|---|---|
REF 1 | Identification of Host Micro RNAs That Differentiate HIV-1 and HIV-2 Infection Using Genome Expression Profiling Techniques. Viruses. 2016 May 2;8(5). pii: E121. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.