Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T74977 Target Info
Target Name Dual specificity protein kinase TTK (MPS1)
Synonyms Tyrosine threonine kinase; Phosphotyrosine picked threonine-protein kinase; PYT; MPS1L1
Target Type Clinical trial Target
Gene Name TTK
Biochemical Class Kinase
UniProt ID
P33981
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-524-5p miRNA Info
miRNA Mature AC
MIMAT0002849
Sequence cuacaaagggaagcacuuucuc
miRNA Species Homo sapiens
Regulation Mechanism hsa-miR-524-5p regulates Ttk. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 2 (CDK2) Target Info
CDK2_HUMAN
Dual specificity protein kinase TTK (MPS1) Target Info
TTK_HUMAN
miRNA Mature ID hsa-miR-376a-5p miRNA Info
miRNA Mature AC
MIMAT0003386
Sequence guagauucuccuucuaugagua
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Dual specificity protein kinase TTK (MPS1) Target Info
TTK_HUMAN
Monocarboxylate transporter 1 (SLC16A1) Target Info
MOT1_HUMAN
References  Top
REF 1 Comprehensive analysis of the functional microRNA-mRNA regulatory network identifies miRNA signatures associated with glioma malignant progression. Nucleic Acids Res. 2013 Dec;41(22):e203.
REF 2 Redirection of silencing targets by adenosine-to-inosine editing of miRNAs. Science. 2007 Feb 23;315(5815):1137-40.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.