Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T75210 Target Info
Target Name LDL receptor related protein-2 (LRP-2)
Synonyms Megalin; Lowdensity lipoprotein receptorrelated protein 2; Low-density lipoprotein receptor-related protein 2; Gp330; Glycoprotein 330
Target Type Literature-reported Target
Gene Name LRP2
Biochemical Class Low density lipoprotein receptor
UniProt ID
P98164
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-146a-5p miRNA Info
miRNA Mature AC
MIMAT0000449
Sequence ugagaacugaauuccauggguu
miRNA Species Homo sapiens
Regulation Mechanism miRNA- 146a has at least three binding sites in the 3'UTR of LRP2. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Activation B7-1 antigen (CD80) Target Info
CD80_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
References  Top
REF 1 MicroRNA-146a represses LRP2 translation and leads to cell apoptosis in Alzheimer's disease. FEBS Lett. 2016 Jul;590(14):2190-200.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.