Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T75962 Target Info
Target Name Stomatin-like protein 2 (STOML2)
Synonyms Stomatin-like protein 2, mitochondrial; SLP2; SLP-2; Paratarg-7; Paraprotein target 7; HSPC108; EPB72-like protein 2
Target Type Literature-reported Target
Gene Name STOML2
UniProt ID
Q9UJZ1
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-1207-5p miRNA Info
miRNA Mature AC
MIMAT0005871
Sequence uggcagggaggcugggagggg
miRNA Species Homo sapiens
Regulation Mechanism STOML-2 protein expression was significantly inhibited in EC9706 and EC-1 cells transfected with the miR-1207-5p mimic. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Macrophage colony-stimulating factor 1 (CSF1) Target Info
CSF1_HUMAN
Signal transducer and activator of transcription 6 (STAT6) Target Info
STAT6_HUMAN
References  Top
REF 1 miRNA-1207-5p is associated with cancer progression by targeting stomatin-like protein 2 in esophageal carcinoma. Int J Oncol. 2015 May;46(5):2163-71.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.