Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T76685 Target Info
Target Name Cannabinoid receptor 1 (CB1)
Synonyms Cannabinoid CB1 receptor; CNR; CB-R; CANN6
Target Type Successful Target
Gene Name CNR1
Biochemical Class GPCR rhodopsin
UniProt ID
P21554
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-494-3p miRNA Info
miRNA Mature AC
MIMAT0002816
Sequence ugaaacauacacgggaaaccuc
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-494 resulted in a significant decrease of CNR1 mRNA as well as CNR1 protein. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
References  Top
REF 1 MicroRNA-665 is involved in the regulation of the expression of the cardioprotective cannabinoid receptor CB2 in patients with severe heart failure. Biochem Biophys Res Commun. 2014 Sep 5;451(4):516-21.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.