miRNA General Information
miRNA Mature ID hsa-miR-494-3p
miRNA Stemloop AC MI0003134
miRNA Stemloop ID hsa-mir-494
Sequence ugaaacauacacgggaaaccuc
TTD Target(s) Regulated by This miRNA Cyclin-dependent kinase 6 (CDK6) Successful Target Target Info [1]
Insulin-like growth factor I receptor (IGF1R) Successful Target Target Info [2]
Apoptosis regulator Bcl-2 (BCL-2) Successful Target Target Info [3]
C-X-C chemokine receptor type 4 (CXCR4) Successful Target Target Info [4]
Cannabinoid receptor 1 (CB1) Successful Target Target Info [5]
cAMP-dependent chloride channel (CFTR) Successful Target Target Info [6]
ERK activator kinase 1 (MEK1) Clinical trial Target Target Info [3]
RAC-alpha serine/threonine-protein kinase (AKT1) Clinical trial Target Target Info [7]
Apoptosis inhibitor survivin (BIRC5) Clinical trial Target Target Info [8]
Syndecan-1 (SDC1) Clinical trial Target Target Info [9]
Tissue factor pathway inhibitor (TFPI) Clinical trial Target Target Info [10]
Phosphatase and tensin homolog (PTEN) Literature-reported Target Target Info [11]
Proto-oncogene c-Myc (MYC) Literature-reported Target Target Info [12]
Polycomb complex protein BMI-1 (BMI1) Literature-reported Target Target Info [13]
Cyclic-AMP-dependent transcription factor ATF-3 (ATF3) Literature-reported Target Target Info [14]
IP3 receptor isoform 1 (ITPR1) Literature-reported Target Target Info [3]
Myosin-2 (MYH2) Literature-reported Target Target Info [15]
Protein(s) Regulated by This miRNA Aryl hydrocarbon receptor nuclear translocator-like protein 1 Regulated Protein [16]
BAG family molecular chaperone regulator 1 Regulated Protein [17]
Bcl-2-like protein 11 Regulated Protein [18]
Chloride anion exchanger Regulated Protein [19]
Colorectal mutant cancer protein Regulated Protein [20]
Forkhead box protein J3 Regulated Protein [21]
Heterogeneous nuclear ribonucleoprotein A3 Regulated Protein [22]
Heterogeneous nuclear ribonucleoprotein Q Regulated Protein [22]
Homeobox protein Hox-A10 Regulated Protein [23]
Microtubule-associated proteins 1A/1B light chain 3B Regulated Protein [24]
Protein disulfide-isomerase A3 Regulated Protein [22]
Rho GTPase-activating protein 5 Regulated Protein [25]
Transcription factor A, mitochondrial Regulated Protein [21]
UDP-glucuronosyltransferase 2B17 Regulated Protein [26]
UV excision repair protein RAD23 homolog B Regulated Protein [22]
Vitamin K-dependent protein S Regulated Protein [27]
Zinc finger E-box-binding homeobox 1 Regulated Protein [13]
References
REF 1 MicroRNA down-regulated in human cholangiocarcinoma control cell cycle through multiple targets involved in the G1/S checkpoint. Hepatology. 2011 Dec;54(6):2089-98.
REF 2 miR-494 suppresses tumor growth of epithelial ovarian carcinoma by targeting IGF1R. Tumour Biol. 2016 Jun;37(6):7767-76.
REF 3 The changes of miRNA expression in rat hippocampus following chronic lead exposure. Toxicol Lett. 2014 Aug 17;229(1):158-66.
REF 4 MicroRNA-494-3p targets CXCR4 to suppress the proliferation, invasion, and migration of prostate cancer. Prostate. 2014 May;74(7):756-67.
REF 5 MicroRNA-665 is involved in the regulation of the expression of the cardioprotective cannabinoid receptor CB2 in patients with severe heart failure. Biochem Biophys Res Commun. 2014 Sep 5;451(4):516-21.
REF 6 Regulation of cystic fibrosis transmembrane conductance regulator by microRNA-145, -223, and -494 is altered in F508 cystic fibrosis airway epithelium. J Immunol. 2013 Apr 1;190(7):3354-62.
REF 7 miR-494-3p Regulates Cellular Proliferation, Invasion, Migration, and Apoptosis by PTEN/AKT Signaling in Human Glioblastoma Cells. Cell Mol Neurobiol. 2015 Jul;35(5):679-87.
REF 8 Targeting survivin using a combination of miR 94 and survivin shRNA has synergistic effects on the suppression of prostate cancer growth. Mol Med Rep. 2016 Feb;13(2):1602-10.
REF 9 Irradiation-induced angiogenesis is associated with an MMP-9-miR-494-syndecan-1 regulatory loop in medulloblastoma cells. Oncogene. 2014 Apr 10;33(15):1922-33.
REF 10 The role of microRNA-27a/b and microRNA-494 in estrogen-mediated downregulation of tissue factor pathway inhibitor . J Thromb Haemost. 2016 Jun;14(6):1226-37.
REF 11 Prediction of mammalian microRNA targets. Cell. 2003 Dec 26;115(7):787-98.
REF 12 miR-494 acts as an anti-oncogene in gastric carcinoma by targeting c-myc. J Gastroenterol Hepatol. 2014;29(7):1427-34.
REF 13 MicroRNAs in the imprinted DLK1-DIO3 region repress the epithelial-to-mesenchymal transition by targeting the TWIST1 protein signaling network. J Biol Chem. 2012 Dec 14;287(51):42695-707.
REF 14 MicroRNA-494 reduces ATF3 expression and promotes AKI. J Am Soc Nephrol. 2012 Dec;23(12):2012-23.
REF 15 MicroRNA-494 plays a role in fiber type-specific skeletal myogenesis in human induced pluripotent stem cells. Biochem Biophys Res Commun. 2015 Dec 4-11;468(1-2):208-13.
REF 16 Expression and rhythmic modulation of circulating microRNAs targeting the clock gene Bmal1 in mice.PLoS One. 2011;6(7):e22586.
REF 17 Cinobufacin suppresses cell proliferation via miR-494 in BGC- 823 gastric cancer cells.Asian Pac J Cancer Prev. 2014;15(3):1241-5.
REF 18 MiR-494 is regulated by ERK1/2 and modulates TRAIL-induced apoptosis in non-small-cell lung cancer through BIM down-regulation.Proc Natl Acad Sci U S A. 2012 Oct 9;109(41):16570-5.
REF 19 Translational repression of SLC26A3 by miR-494 in intestinal epithelial cells.Am J Physiol Gastrointest Liver Physiol. 2014 Jan;306(2):G123-31.
REF 20 MicroRNA-494 within an oncogenic microRNA megacluster regulates G1/S transition in liver tumorigenesis through suppression of mutated in colorectal cancer.Hepatology. 2014 Jan;59(1):202-15.
REF 21 MicroRNA-494 regulates mitochondrial biogenesis in skeletal muscle through mitochondrial transcription factor A and Forkhead box j3.Am J Physiol Endocrinol Metab. 2012 Dec 15;303(12):E1419-27.
REF 22 Identification of miR-494 direct targets involved in senescence of human diploid fibroblasts.FASEB J. 2014 Aug;28(8):3720-33.
REF 23 miR-494 represses HOXA10 expression and inhibits cell proliferation in oral cancer.Oral Oncol. 2015 Feb;51(2):151-7.
REF 24 MIR494 reduces renal cancer cell survival coinciding with increased lipid droplets and mitochondrial changes.BMC Cancer. 2016 Jan 21;16:33.
REF 25 Ionizing radiation-inducible miR-494 promotes glioma cell invasion through EGFR stabilization by targeting p190B rhoGAP.Biochim Biophys Acta. 2014 Mar;1843(3):508-16.
REF 26 Epigenetic regulation of steroid inactivating UDP-glucuronosyltransferases by microRNAs in prostate cancer.J Steroid Biochem Mol Biol. 2016 Jan;155(Pt A):85-93.
REF 27 Micro-ribonucleic Acid 494 regulation of protein S expression.J Thromb Haemost. 2013 Aug;11(8):1547-55.
REF 28 MicroRNAs in the imprinted DLK1-DIO3 region repress the epithelial-to-mesenchymal transition by targeting the TWIST1 protein signaling network. J Biol Chem. 2012 Dec 14;287(51):42695-707.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.