Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T78311 |
Target Info
|
| Target Name |
Nucleus accumbens-associated protein 1 (NACC1) |
| Synonyms |
NAC1; NAC-1; BTBD14B; BTB/POZ domain-containing protein 14B |
| Target Type |
Literature-reported Target |
| Gene Name |
NACC1 |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-331-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
gccccugggccuauccuagaa
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-331-3p and syndecan-1 axis regulates expression of NACC1 and promotes EMT in prostate cancer cells. |
[2] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Immunohistochemistry; RT-PCR |
[1] |
| 2 |
qRT-PCR |
[2] |
| Representative Target(s) Regulated by This miRNA |
E2F transcription factor 1 (E2F1)
|
Target Info
|
|
|
Erbb2 tyrosine kinase receptor (HER2)
|
Target Info
|
|
| References |
Top |
| REF 1 |
NACC1, as a Target of MicroRNA-331-3p, Regulates Cell Proliferation in Urothelial Carcinoma Cells. Cancers (Basel). 2018 Sep 21;10(10). pii: E347.
|
| REF 2 |
Syndecan-1 up-regulates microRNA-331-3p and mediates epithelial-to-mesenchymal transition in prostate cancer. Mol Carcinog. 2016 Sep;55(9):1378-86.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
