Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T78543 Target Info
Target Name Protein kinase G1 (PRKG1)
Synonyms cGMP-dependent protein kinase I; cGMP-dependent protein kinase 1; cGKI; cGK1; cGK 1; PRKGR1B; PRKGR1A; PRKG1B
Target Type Literature-reported Target
Gene Name PRKG1
Biochemical Class Kinase
UniProt ID
Q13976
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-20a-5p miRNA Info
miRNA Mature AC
MIMAT0000075
Sequence uaaagugcuuauagugcagguag
miRNA Species Homo sapiens
Regulation Mechanism PKG is a downstream target of miR-20a. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
References  Top
REF 1 MiR-20a regulates the PRKG1 gene by targeting its coding region in pulmonary arterial smooth muscle cells. FEBS Lett. 2014 Dec 20;588(24):4677-85.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.