Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T78567 |
Target Info
|
| Target Name |
Oncostatin-M-specific receptor beta (OSMR) |
| Synonyms |
Oncostatin-M-specific receptor subunit beta; OSMRB; Interleukin-31 receptor subunit beta; IL-31RB; IL-31R-beta; IL-31R subunit beta; IL-31 receptor subunit beta |
| Target Type |
Literature-reported Target |
| Gene Name |
OSMR |
| Biochemical Class |
Cytokine receptor |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-122-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uggagugugacaaugguguuug
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Literature Reported |
[1] |
| 2 |
Luciferase Reporter Assay |
[2] |
| Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-W (BCL-W)
|
Target Info
|
|
|
Apoptosis regulator Bcl-xL (BCL-xL)
|
Target Info
|
|
| References |
Top |
| REF 1 |
Mining of single nucleotide polymorphisms in the 3' untranslated region of liver cancer-implicated miR-122 target genes. Ann Transl Med. 2016 Mar;4(5):102.
|
| REF 2 |
MicroRNA-122, a tumor suppressor microRNA that regulates intrahepatic metastasis of hepatocellular carcinoma. Hepatology. 2009 May;49(5):1571-82.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
