miRNA Details

miRNA General Information
miRNA Mature ID hsa-miR-122-5p
miRNA Stemloop AC MI0000442
miRNA Stemloop ID hsa-mir-122
Sequence uggagugugacaaugguguuug
TTD Target(s) Regulated by This miRNA Epidermal growth factor receptor (EGFR) Successful Target Target Info [1]
Cyclin-dependent kinase 4 (CDK4) Successful Target Target Info [2]
Insulin-like growth factor I receptor (IGF1R) Successful Target Target Info [3]
Tyrosine-protein kinase UFO (AXL) Successful Target Target Info [4]
Transforming growth factor beta 1 (TGFB1) Successful Target Target Info [5]
TNF alpha converting enzyme (ADAM17) Clinical trial Target Target Info [6]
RAC-gamma serine/threonine-protein kinase (AKT3) Successful Target Target Info [6]
Stress-activated protein kinase 2b (p38 beta) Clinical trial Target Target Info [6]
Apoptosis regulator Bcl-W (BCL-W) Clinical trial Target Target Info [7]
Apoptosis regulator Bcl-xL (BCL-xL) Clinical trial Target Target Info [7]
Heme oxygenase 1 (HMOX1) Clinical trial Target Target Info [8]
Mammalian disintegrin-metalloprotease (ADAM10) Clinical trial Target Target Info [3]
Protein-tyrosine phosphatase 1B (PTP1B) Clinical trial Target Target Info [9]
Interleukin-1 alpha (IL1A) Clinical trial Target Target Info [10]
Prolyl 4-hydroxylasesubunit alpha-1 (P4HA1) Clinical trial Target Target Info [11]
Pyruvate kinase M2 (PKM) Clinical trial Target Target Info [12]
Vascular endothelial growth factor C (VEGFC) Clinical trial Target Target Info [13]
Claudin-18 (CLDN18) Clinical trial Target Target Info [6]
Pattern recognition receptor NOD2 (NOD2) Clinical trial Target Target Info [14]
Transforming protein RhoA (RHOA) Discontinued Target Target Info [15]
MAPK/ERK kinase kinase 3 (MAP3K3) Literature-reported Target Target Info [16]
Ras-related C3 botulinum toxin substrate 1 (RAC1) Literature-reported Target Target Info [17]
Citrate synthase (CS) Literature-reported Target Target Info [6]
Cyclic AMP-responsive element-binding protein (CREB1) Literature-reported Target Target Info [8]
Sodium pump alpha-2 (ATP1A2) Literature-reported Target Target Info [6]
Cystine/glutamate transporter (SLC7A11) Clinical trial Target Target Info [6]
High-affinity cationic amino acid transporter-1 (SLC7A1) Literature-reported Target Target Info [18]
Methyl cpg binding protein 2 (MECP2) Clinical trial Target Target Info [8]
Oncostatin-M-specific receptor beta (OSMR) Literature-reported Target Target Info [6]
Suppressor of cytokine signaling 1 (SOCS1) Literature-reported Target Target Info [19]
Protein(s) Regulated by This miRNA 5'-AMP-activated protein kinase subunit beta-1 Regulated Protein
AAKB1_HUMAN
[20]
Acetoacetyl-CoA synthetase Regulated Protein
AACS_HUMAN
[6]
Activin receptor type-1C Regulated Protein
ACV1C_HUMAN
[22]
Alpha-(1,6)-fucosyltransferase Regulated Protein
FUT8_HUMAN
[23]
Ankyrin-2 Regulated Protein
ANK2_HUMAN
[6]
Annexin A11 Regulated Protein
ANX11_HUMAN
[6]
AP-3 complex subunit mu-2 Regulated Protein
AP3M2_HUMAN
[6]
Apoptosis regulator BAX Regulated Protein
BAX_HUMAN
[7]
Chloride intracellular channel protein 4 Regulated Protein
CLIC4_HUMAN
[25]
Cholesterol 7-alpha-monooxygenase Regulated Protein
CP7A1_HUMAN
[26]
CTD nuclear envelope phosphatase 1 Regulated Protein
CNEP1_HUMAN
[27]
Cyclin-G1 Regulated Protein
CCNG1_HUMAN
[28]
Cytosolic 5'-nucleotidase 3A Regulated Protein
5NT3A_HUMAN
[29]
Dual serine/threonine and tyrosine protein kinase Regulated Protein
DUSTY_HUMAN
[6]
Dual specificity protein phosphatase 2 Regulated Protein
DUS2_HUMAN
[6]
Ectonucleoside triphosphate diphosphohydrolase 4 Regulated Protein
ENTP4_HUMAN
[6]
Egl nine homolog 3 Regulated Protein
EGLN3_HUMAN
[6]
Exportin-6 Regulated Protein
XPO6_HUMAN
[6]
Forkhead box protein J3 Regulated Protein
FOXJ3_HUMAN
[6]
Forkhead box protein P1 Regulated Protein
FOXP1_HUMAN
[6]
Fructose-bisphosphate aldolase A Regulated Protein
ALDOA_HUMAN
[6]
FUN14 domain-containing protein 2 Regulated Protein
FUND2_HUMAN
[6]
Glucose-6-phosphatase 3 Regulated Protein
G6PC3_HUMAN
[6]
Glycogen [starch] synthase, muscle Regulated Protein
GYS1_HUMAN
[30]
Homeobox protein cut-like 1 Regulated Protein
CUX1_HUMAN
[31]
Interferon-inducible double-stranded RNA-dependent protein kinase activator A Regulated Protein
PRKRA_HUMAN
[32]
Myocyte-specific enhancer factor 2D Regulated Protein
MEF2D_HUMAN
[33]
Neural cell adhesion molecule 1 Regulated Protein
NCAM1_HUMAN
[6]
NFATC2-interacting protein Regulated Protein
NF2IP_HUMAN
[6]
Numb-like protein Regulated Protein
NUMBL_HUMAN
[6]
Phosphatidate phosphatase LPIN1 Regulated Protein
LPIN1_HUMAN
[27]
Polypeptide N-acetylgalactosaminyltransferase 10 Regulated Protein
GLT10_HUMAN
[6]
Protein FAM117B Regulated Protein
F117B_HUMAN
[6]
Protein sprouty homolog 2 Regulated Protein
SPY2_HUMAN
[34]
Proto-oncogene Wnt-1 Regulated Protein
WNT1_HUMAN
[35]
Rab11 family-interacting protein 1 Regulated Protein
RFIP1_HUMAN
[6]
Ras-related protein Rab-6B Regulated Protein
RAB6B_HUMAN
[6]
Retrotransposon-derived protein PEG10 Regulated Protein
PEG10_HUMAN
[36]
Serum response factor Regulated Protein
SRF_HUMAN
[3]
T-box transcription factor TBX19 Regulated Protein
TBX19_HUMAN
[6]
Transcription initiation factor IIB Regulated Protein
TF2B_HUMAN
[30]
Tribbles homolog 1 Regulated Protein
TRIB1_HUMAN
[6]
Tumor protein D54 Regulated Protein
TPD54_HUMAN
[6]
Ubiquitin-associated protein 2 Regulated Protein
UBAP2_HUMAN
[6]
Zinc finger protein 395 Regulated Protein
ZN395_HUMAN
[38]
[Pyruvate dehydrogenase (acetyl-transferring)] kinase isozyme 4, mitochondrial Regulated Protein
PDK4_HUMAN
[39]
References
REF 1 MicroRNA-122a Regulates Zonulin by Targeting EGFR in Intestinal Epithelial Dysfunction. Cell Physiol Biochem. 2017;42(2):848-858.
REF 2 Modulation of the unfolded protein response is the core of microRNA-122-involved sensitivity to chemotherapy in hepatocellular carcinoma. Neoplasia. 2011 Jul;13(7):590-600.
REF 3 MicroRNA-122 inhibits tumorigenic properties of hepatocellular carcinoma cells and sensitizes these cells to sorafenib. J Biol Chem. 2009 Nov 13;284(46):32015-27.
REF 4 Hepatic loss of miR-122 predisposes mice to hepatobiliary cyst and hepatocellular carcinoma upon diethylnitrosamine exposure. Am J Pathol. 2013 Dec;183(6):1719-1730.
REF 5 microRNA-122 down-regulation may play a role in severe myocardial fibrosis in human aortic stenosis through TGF-1 up-regulation. Clin Sci (Lond). 2014 Apr;126(7):497-506.
REF 6 MicroRNA-122, a tumor suppressor microRNA that regulates intrahepatic metastasis of hepatocellular carcinoma. Hepatology. 2009 May;49(5):1571-82.
REF 7 miR-122 targets an anti-apoptotic gene, Bcl-w, in human hepatocellular carcinoma cell lines. Biochem Biophys Res Commun. 2008 Oct 24;375(3):315-20.
REF 8 MicroRNA targeting specificity in mammals: determinants beyond seed pairing. Mol Cell. 2007 Jul 6;27(1):91-105.
REF 9 Decrease of microRNA-122 causes hepatic insulin resistance by inducing protein tyrosine phosphatase 1B, which is reversed by licorice flavonoid. Hepatology. 2012 Dec;56(6):2209-20.
REF 10 An insertion/deletion polymorphism at the microRNA-122 binding site in the interleukin-1 3'-untranslated region is associated with a risk for osteoarthritis. Mol Med Rep. 2015 Oct;12(4):6199-206.
REF 11 miR-122 regulates collagen production via targeting hepatic stellate cells and suppressing P4HA1 expression. J Hepatol. 2013 Mar;58(3):522-8.
REF 12 Insights into snoRNA biogenesis and processing from PAR-CLIP of snoRNA core proteins and small RNA sequencing. Genome Biol. 2013 May 26;14(5):R45.
REF 13 MiR-122 targets VEGFC in bladder cancer to inhibit tumor growth and angiogenesis. Am J Transl Res. 2016 Jul 15;8(7):3056-66.
REF 14 miR-122 targets NOD2 to decrease intestinal epithelial cell injury in Crohn's disease. Biochem Biophys Res Commun. 2013 Aug 16;438(1):133-9.
REF 15 Loss of miR-122 expression in liver cancer correlates with suppression of the hepatic phenotype and gain of metastatic properties. Oncogene. 2009 Oct 8;28(40):3526-36.
REF 16 Liver-enriched transcription factors regulate microRNA-122 that targets CUTL1 during liver development. Hepatology. 2010 Oct;52(4):1431-42.
REF 17 The microRNA network and tumor metastasis. Oncogene. 2010 Feb 18;29(7):937-48.
REF 18 Relief of microRNA-mediated translational repression in human cells subjected to stress. Cell. 2006 Jun 16;125(6):1111-24.
REF 19 MiR-122 modulates type I interferon expression through blocking suppressor of cytokine signaling 1. Int J Biochem Cell Biol. 2013 Apr;45(4):858-65.
REF 20 miR-122 regulation of lipid metabolism revealed by in vivo antisense targeting. Cell Metab. 2006 Feb;3(2):87-98.
REF 21 MicroRNA-122, a tumor suppressor microRNA that regulates intrahepatic metastasis of hepatocellular carcinoma. Hepatology. 2009 May;49(5):1571-82.
REF 22 MicroRNA 376c enhances ovarian cancer cell survival by targeting activin receptor-like kinase 7: implications for chemoresistance.J Cell Sci. 2011 Feb 1;124(Pt 3):359-68.
REF 23 Effects of microRNAs on fucosyltransferase 8 (FUT8) expression in hepatocarcinoma cells.PLoS One. 2013 Oct 9;8(10):e76540.
REF 24 miR-122 targets an anti-apoptotic gene, Bcl-w, in human hepatocellular carcinoma cell lines. Biochem Biophys Res Commun. 2008 Oct 24;375(3):315-20.
REF 25 A miRNA-responsive cell-free translation system facilitates isolation of hepatitis C virus miRNP complexes.RNA. 2013 Aug;19(8):1159-69.
REF 26 A putative role of micro RNA in regulation of cholesterol 7alpha-hydroxylase expression in human hepatocytes.J Lipid Res. 2010 Aug;51(8):2223-33.
REF 27 Two Triacylglycerol Pathway Genes, CTDNEP1 and LPIN1, are Down-Regulated by hsa-miR-122-5p in Hepatocytes.Arch Iran Med. 2017 Mar;20(3):165-171.
REF 28 Cyclin G1 is a target of miR-122a, a microRNA frequently down-regulated in human hepatocellular carcinoma.Cancer Res. 2007 Jul 1;67(13):6092-9.
REF 29 Inhibition of alpha interferon (IFN-)-induced microRNA-122 negatively affects the anti-hepatitis B virus efficiency of IFN-.J Virol. 2013 Jan;87(1):137-47.
REF 30 miR-122 targeting with LNA/2'-O-methyl oligonucleotide mixmers, peptide nucleic acids (PNA), and PNA-peptide conjugates. RNA. 2008 Feb;14(2):336-46.
REF 31 MicroRNA-122 down-regulation is involved in phenobarbital-mediated activation of the constitutive androstane receptor.PLoS One. 2012;7(7):e41291.
REF 32 Hepato-specific microRNA-122 facilitates accumulation of newly synthesized miRNA through regulating PRKRA.Nucleic Acids Res. 2012 Jan;40(2):884-91.
REF 33 Overexpression of the transcription factor MEF2D in hepatocellular carcinoma sustains malignant character by suppressing G2-M transition genes.Cancer Res. 2014 Mar 1;74(5):1452-62.
REF 34 IL-22-induced miR-122-5p promotes keratinocyte proliferation by targeting Sprouty2.Exp Dermatol. 2017 Apr;26(4):368-374.
REF 35 MicroRNA-122 suppresses cell proliferation and induces cell apoptosis in hepatocellular carcinoma by directly targeting Wnt/-catenin pathway.Liver Int. 2012 May;32(5):752-60.
REF 36 miR-122-mediated translational repression of PEG10 and its suppression in human hepatocellular carcinoma.J Transl Med. 2016 Jul 2;14(1):200.
REF 37 MicroRNA-122 inhibits tumorigenic properties of hepatocellular carcinoma cells and sensitizes these cells to sorafenib. J Biol Chem. 2009 Nov 13;284(46):32015-27.
REF 38 Hepatitis B virus mRNA-mediated miR-122 inhibition upregulates PTTG1-binding protein, which promotes hepatocellular carcinoma tumor growth and cell invasion.J Virol. 2013 Feb;87(4):2193-205.
REF 39 Active glycolytic metabolism in CD133(+) hepatocellular cancer stem cells: regulation by MIR-122.Oncotarget. 2015 Dec 1;6(38):40822-35.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.