Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T81311 |
Target Info
|
| Target Name |
Endoplasmin (HSP90B1) |
| Synonyms |
gp96 homolog; Tumor rejection antigen 1; TRA1; Heat shock protein 90 kDa beta member 1; GRP94; GRP-94; 94 kDa glucoseregulated protein; 94 kDa glucose-regulated protein |
| Target Type |
Clinical trial Target |
| Gene Name |
HSP90B1 |
| Biochemical Class |
Heat shock protein |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-223-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
ugucaguuugucaaauacccca
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-223 interacts with the Hsp90B1 3'UTR. |
[1] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Reporter Assay |
[1] |
| 2 |
Luciferase Reporter Assay; Western Blot |
[2] |
| Representative Target(s) Regulated by This miRNA |
ATM serine/threonine kinase (ATM)
|
Target Info
|
|
|
C-X-C motif chemokine 2 (CXCL2)
|
Target Info
|
|
| References |
Top |
| REF 1 |
Heat shock protein 90B1 plays an oncogenic role and is a target of microRNA-223 in human osteosarcoma. Cell Physiol Biochem. 2012;30(6):1481-90.
|
| REF 2 |
MicroRNA-223 is a novel negative regulator of HSP90B1 in CLL. BMC Cancer. 2015 Apr 8;15:238.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
