miRNA Details
miRNA General Information | |||||
---|---|---|---|---|---|
miRNA Mature ID | hsa-miR-223-3p | ||||
miRNA Stemloop AC | MI0000300 | ||||
miRNA Stemloop ID | hsa-mir-223 | ||||
Sequence | ugucaguuugucaaauacccca | ||||
TTD Target(s) Regulated by This miRNA | Insulin-like growth factor I receptor (IGF1R) | Successful Target | Target Info | [1] | |
Multidrug resistance protein 1 (ABCB1) | Successful Target | Target Info | [2] | ||
Poly [ADP-ribose] polymerase 1 (PARP1) | Successful Target | Target Info | [3] | ||
Interleukin-6 (IL6) | Successful Target | Target Info | [4] | ||
Signal transducer and activator of transcription 3 (STAT3) | Successful Target | Target Info | [5] | ||
cAMP-dependent chloride channel (CFTR) | Successful Target | Target Info | [6] | ||
Cyclin-dependent kinase 2 (CDK2) | Clinical trial Target | Target Info | [7] | ||
ATM serine/threonine kinase (ATM) | Clinical trial Target | Target Info | [8] | ||
C-X-C motif chemokine 2 (CXCL2) | Clinical trial Target | Target Info | [4] | ||
Nicotinamide phosphoribosyltransferase (NAMPT) | Clinical trial Target | Target Info | [9] | ||
Endoplasmin (HSP90B1) | Clinical trial Target | Target Info | [10] | ||
Glucose transporter type 4 (SLC2A4) | Clinical trial Target | Target Info | [11] | ||
Macrophage inflammatory protein 1-alpha (CCL3) | Clinical trial Target | Target Info | [4] | ||
E2F transcription factor 1 (E2F1) | Clinical trial Target | Target Info | [12] | ||
Caterpiller protein 1.1 (NLRP3) | Clinical trial Target | Target Info | [13] | ||
Transcription factor Sp1 (SP1) | Clinical trial Target | Target Info | [14] | ||
Signal transducer and activator of transcription 1 (STAT1) | Patented-recorded Target | Target Info | [15] | ||
Inhibitor of nuclear factor kappa-B kinase alpha (IKKA) | Literature-reported Target | Target Info | [16] | ||
Histone-arginine methyltransferase CARM1 (CARM1) | Literature-reported Target | Target Info | [17] | ||
Forkhead box protein O1A (FOXO1) | Literature-reported Target | Target Info | [18] | ||
F-box and WD-40 domain protein 7 (Fbxw7) | Literature-reported Target | Target Info | [19] | ||
Insulin receptor substrate-1 (IRS1) | Clinical trial Target | Target Info | [20] | ||
Leukemia inhibitory factor (LIF) | Clinical trial Target | Target Info | [21] | ||
Rhombotin-2 (LMO2) | Literature-reported Target | Target Info | [22] | ||
Scavenger receptor class B member 1 (SCARB1) | Literature-reported Target | Target Info | [23] | ||
HCLS1-associated protein X-1 (HAX1) | Literature-reported Target | Target Info | [24] | ||
Stathmin-1 (STMN1) | Literature-reported Target | Target Info | [25] | ||
Protein(s) Regulated by This miRNA | Artemin | Regulated Protein | [26] | ||
Band 4.1-like protein 3 | Regulated Protein | [27] | |||
Caprin-1 | Regulated Protein | [28] | |||
Cell division cycle protein 27 homolog | Regulated Protein | [14] | |||
Cytochrome b5 | Regulated Protein | [30] | |||
DNA-directed RNA polymerase III subunit RPC7 | Regulated Protein | [14] | |||
Forkhead box protein O3 | Regulated Protein | [14] | |||
Methylsterol monooxygenase 1 | Regulated Protein | [9] | |||
Myocyte-specific enhancer factor 2C | Regulated Protein | [32] | |||
Myosin regulatory light polypeptide 9 | Regulated Protein | [33] | |||
Nuclear factor 1 A-type | Regulated Protein | [34] | |||
Nuclear factor 1 X-type | Regulated Protein | [35] | |||
Paired box protein Pax-6 | Regulated Protein | [36] | |||
Phosphatidate cytidylyltransferase 1 | Regulated Protein | [9] | |||
Polypyrimidine tract-binding protein 2 | Regulated Protein | [37] | |||
PR domain zinc finger protein 1 | Regulated Protein | [38] | |||
Protein ECT2 | Regulated Protein | [39] | |||
Protein ZNF365 | Regulated Protein | [9] | |||
Rho-related GTP-binding protein RhoB | Regulated Protein | [35] | |||
Selenocysteine insertion sequence-binding protein 2-like | Regulated Protein | [9] | |||
Semaphorin-3A | Regulated Protein | [5] | |||
Sorting nexin-24 | Regulated Protein | [9] | |||
SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily D member 1 | Regulated Protein | [3] | |||
T-cell acute lymphocytic leukemia protein 1 | Regulated Protein | [42] | |||
Thymocyte selection-associated high mobility group box protein TOX | Regulated Protein | [43] | |||
Transcription factor MafB | Regulated Protein | [44] | |||
Transcription factor Sp3 | Regulated Protein | [21] | |||
Twinfilin-1 | Regulated Protein | [9] | |||
Zinc finger E-box-binding homeobox 1 | Regulated Protein | [46] | |||
References | |||||
REF 1 | MiR-223 suppresses cell proliferation by targeting IGF-1R. PLoS One. 2011;6(11):e27008. | ||||
REF 2 | MiR-223 modulates multidrug resistance via downregulation of ABCB1 in hepatocellular carcinoma cells. Exp Biol Med (Maywood). 2013 Sep;238(9):1024-32. | ||||
REF 3 | MicroRNA 223 is upregulated in the multistep progression of Barrett's esophagus and modulates sensitivity to chemotherapy by targeting PARP1. Clin Cancer Res. 2013 Aug 1;19(15):4067-78. | ||||
REF 4 | MicroRNA-223 controls susceptibility to tuberculosis by regulating lung neutrophil recruitment. J Clin Invest. 2013 Nov;123(11):4836-48. | ||||
REF 5 | Exosomal miR-223 Contributes to Mesenchymal Stem Cell-Elicited Cardioprotection in Polymicrobial Sepsis. Sci Rep. 2015 Sep 8;5:13721. | ||||
REF 6 | Regulation of cystic fibrosis transmembrane conductance regulator by microRNA-145, -223, and -494 is altered in F508 cystic fibrosis airway epithelium. J Immunol. 2013 Apr 1;190(7):3354-62. | ||||
REF 7 | miR-223 functions as a potent tumor suppressor of the Lewis lung carcinoma cell line by targeting insulin-like growth factor-1 receptor and cyclin-... Oncol Lett. 2013 Aug;6(2):359-366. | ||||
REF 8 | MicroRNA-223 enhances radiation sensitivity of U87MG cells in vitro and in vivo by targeting ataxia telangiectasia mutated. Int J Radiat Oncol Biol Phys. 2014 Mar 15;88(4):955-60. | ||||
REF 9 | MicroRNA profiling in mucosal biopsies of eosinophilic esophagitis patients pre and post treatment with steroids and relationship with mRNA targets. PLoS One. 2012;7(7):e40676. | ||||
REF 10 | Heat shock protein 90B1 plays an oncogenic role and is a target of microRNA-223 in human osteosarcoma. Cell Physiol Biochem. 2012;30(6):1481-90. | ||||
REF 11 | MicroRNA-223 regulates Glut4 expression and cardiomyocyte glucose metabolism. Cardiovasc Res. 2010 Jun 1;86(3):410-20. | ||||
REF 12 | Cell-cycle regulator E2F1 and microRNA-223 comprise an autoregulatory negative feedback loop in acute myeloid leukemia. Blood. 2010 Mar 4;115(9):1768-78. | ||||
REF 13 | The RNA-binding protein Tristetraprolin (TTP) is a critical negative regulator of the NLRP3 inflammasome. J Biol Chem. 2017 Apr 28;292(17):6869-6881. | ||||
REF 14 | Decoy oligonucleotide rescues IGF1R expression from MicroRNA-223 suppression. PLoS One. 2013 Dec 4;8(12):e82167. | ||||
REF 15 | STAT1: A Novel Target of miR-150 and miR-223 Is Involved in the Proliferation of HTLV-I-Transformed and ATL Cells. Neoplasia. 2015 May;17(5):449-62. | ||||
REF 16 | MicroRNAs modulate the noncanonical transcription factor NF-kappaB pathway by regulating expression of the kinase IKKalpha during macrophage differentiation. Nat Immunol. 2010 Sep;11(9):799-805. | ||||
REF 17 | PRMT4 blocks myeloid differentiation by assembling a methyl-RUNX1-dependent repressor complex. Cell Rep. 2013 Dec 26;5(6):1625-38. | ||||
REF 18 | MicroRNA-223 regulates FOXO1 expression and cell proliferation. FEBS Lett. 2012 Apr 5;586(7):1038-43. | ||||
REF 19 | MicroRNA-223 functions as an oncogene in human gastric cancer by targeting FBXW7/hCdc4. J Cancer Res Clin Oncol. 2012 May;138(5):763-74. | ||||
REF 20 | Micro RNA 145 targets the insulin receptor substrate-1 and inhibits the growth of colon cancer cells. J Biol Chem. 2007 Nov 9;282(45):32582-90. | ||||
REF 21 | Interplay between HIV-1 infection and host microRNAs. Nucleic Acids Res. 2012 Mar;40(5):2181-96. | ||||
REF 22 | MicroRNA-223 reversibly regulates erythroid and megakaryocytic differentiation of K562 cells. J Cell Mol Med. 2009 Nov-Dec;13(11-12):4551-9. | ||||
REF 23 | MicroRNAs 185, 96, and 223 repress selective high-density lipoprotein cholesterol uptake through posttranscriptional inhibition. Mol Cell Biol. 2013 May;33(10):1956-64. | ||||
REF 24 | MicroRNA-223 Increases the Sensitivity of Triple-Negative Breast Cancer Stem Cells to TRAIL-Induced Apoptosis by Targeting HAX-1. PLoS One. 2016 Sep 12;11(9):e0162754. | ||||
REF 25 | MicroRNA-223 is commonly repressed in hepatocellular carcinoma and potentiates expression of Stathmin1. Gastroenterology. 2008 Jul;135(1):257-69. | ||||
REF 26 | miR-223 regulates migration and invasion by targeting Artemin in human esophageal carcinoma.J Biomed Sci. 2011 Mar 31;18:24. | ||||
REF 27 | miRNA-223 promotes gastric cancer invasion and metastasis by targeting tumor suppressor EPB41L3.Mol Cancer Res. 2011 Jul;9(7):824-33. | ||||
REF 28 | Caprin-1 is a novel microRNA-223 target for regulating the proliferation and invasion of human breast cancer cells.Biomed Pharmacother. 2013 Sep;67(7):629-36. | ||||
REF 29 | Decoy oligonucleotide rescues IGF1R expression from MicroRNA-223 suppression. PLoS One. 2013 Dec 4;8(12):e82167. | ||||
REF 30 | Regulation of cytochrome b5 expression by miR-223 in human liver: effects on cytochrome P450 activities.Pharm Res. 2014 Mar;31(3):780-94. | ||||
REF 31 | MicroRNA profiling in mucosal biopsies of eosinophilic esophagitis patients pre and post treatment with steroids and relationship with mRNA targets. PLoS One. 2012;7(7):e40676. | ||||
REF 32 | Regulation of progenitor cell proliferation and granulocyte function by microRNA-223.Nature. 2008 Feb 28;451(7182):1125-9. | ||||
REF 33 | MicroRNA-223 Attenuates Hypoxia-induced Vascular Remodeling by Targeting RhoB/MLC2 in Pulmonary Arterial Smooth Muscle Cells.Sci Rep. 2016 Apr 28;6:24900. | ||||
REF 34 | Epigenetic silencing of the myelopoiesis regulator microRNA-223 by the AML1/ETO oncoprotein.Cancer Cell. 2007 Nov;12(5):457-66. | ||||
REF 35 | Sequence context outside the target region influences the effectiveness of miR-223 target sites in the RhoB 3'UTR.Nucleic Acids Res. 2010 Jan;38(1):239-52. | ||||
REF 36 | microRNA-223 promotes the growth and invasion of glioblastoma cells by targeting tumor suppressor PAX6.Oncol Rep. 2013 Nov;30(5):2263-9. | ||||
REF 37 | BCR-ABL mediated repression of miR-223 results in the activation of MEF2C and PTBP2 in chronic myeloid leukemia.Leukemia. 2013 Jul;27(7):1578-80. | ||||
REF 38 | The downregulation of PRDM1/Blimp-1 is associated with aberrant expression of miR-223 in extranodal NK/T-cell lymphoma, nasal type.J Exp Clin Cancer Res. 2014 Jan 17;33:7. | ||||
REF 39 | MiR-223/Ect2/p21 signaling regulates osteosarcoma cell cycle progression and proliferation.Biomed Pharmacother. 2013 Jun;67(5):381-6. | ||||
REF 40 | Exosomal miR-223 Contributes to Mesenchymal Stem Cell-Elicited Cardioprotection in Polymicrobial Sepsis. Sci Rep. 2015 Sep 8;5:13721. | ||||
REF 41 | MicroRNA 223 is upregulated in the multistep progression of Barrett's esophagus and modulates sensitivity to chemotherapy by targeting PARP1. Clin Cancer Res. 2013 Aug 1;19(15):4067-78. | ||||
REF 42 | The TAL1 complex targets the FBXW7 tumor suppressor by activating miR-223 in human T cell acute lymphoblastic leukemia.J Exp Med. 2013 Jul 29;210(8):1545-57. | ||||
REF 43 | miR-223 regulates cell growth and targets proto-oncogenes in mycosis fungoides/cutaneous T-cell lymphoma.J Invest Dermatol. 2014 Apr;134(4):1101-1107. | ||||
REF 44 | MiR-223 targeting MAFB suppresses proliferation and migration of nasopharyngeal carcinoma cells.BMC Cancer. 2015 Jun 9;15:461. | ||||
REF 45 | Interplay between HIV-1 infection and host microRNAs. Nucleic Acids Res. 2012 Mar;40(5):2181-96. | ||||
REF 46 | Ginkgolide B Inhibits Human Bladder Cancer Cell Migration and Invasion Through MicroRNA-223-3p. Cell Physiol Biochem. 2016;39(5):1787-1794. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.