miRNA General Information
miRNA Mature ID hsa-miR-223-3p
miRNA Stemloop AC MI0000300
miRNA Stemloop ID hsa-mir-223
Sequence ugucaguuugucaaauacccca
TTD Target(s) Regulated by This miRNA Insulin-like growth factor I receptor (IGF1R) Successful Target Target Info [1]
Multidrug resistance protein 1 (ABCB1) Successful Target Target Info [2]
Poly [ADP-ribose] polymerase 1 (PARP1) Successful Target Target Info [3]
Interleukin-6 (IL6) Successful Target Target Info [4]
Signal transducer and activator of transcription 3 (STAT3) Successful Target Target Info [5]
cAMP-dependent chloride channel (CFTR) Successful Target Target Info [6]
Cyclin-dependent kinase 2 (CDK2) Clinical trial Target Target Info [7]
ATM serine/threonine kinase (ATM) Clinical trial Target Target Info [8]
C-X-C motif chemokine 2 (CXCL2) Clinical trial Target Target Info [4]
Nicotinamide phosphoribosyltransferase (NAMPT) Clinical trial Target Target Info [9]
Endoplasmin (HSP90B1) Clinical trial Target Target Info [10]
Glucose transporter type 4 (SLC2A4) Clinical trial Target Target Info [11]
Macrophage inflammatory protein 1-alpha (CCL3) Clinical trial Target Target Info [4]
E2F transcription factor 1 (E2F1) Clinical trial Target Target Info [12]
Caterpiller protein 1.1 (NLRP3) Clinical trial Target Target Info [13]
Transcription factor Sp1 (SP1) Clinical trial Target Target Info [14]
Signal transducer and activator of transcription 1 (STAT1) Patented-recorded Target Target Info [15]
Inhibitor of nuclear factor kappa-B kinase alpha (IKKA) Literature-reported Target Target Info [16]
Histone-arginine methyltransferase CARM1 (CARM1) Literature-reported Target Target Info [17]
Forkhead box protein O1A (FOXO1) Literature-reported Target Target Info [18]
F-box and WD-40 domain protein 7 (Fbxw7) Literature-reported Target Target Info [19]
Insulin receptor substrate-1 (IRS1) Clinical trial Target Target Info [20]
Leukemia inhibitory factor (LIF) Clinical trial Target Target Info [21]
Rhombotin-2 (LMO2) Literature-reported Target Target Info [22]
Scavenger receptor class B member 1 (SCARB1) Literature-reported Target Target Info [23]
HCLS1-associated protein X-1 (HAX1) Literature-reported Target Target Info [24]
Stathmin-1 (STMN1) Literature-reported Target Target Info [25]
Protein(s) Regulated by This miRNA Artemin Regulated Protein [26]
Band 4.1-like protein 3 Regulated Protein [27]
Caprin-1 Regulated Protein [28]
Cell division cycle protein 27 homolog Regulated Protein [14]
Cytochrome b5 Regulated Protein [30]
DNA-directed RNA polymerase III subunit RPC7 Regulated Protein [14]
Forkhead box protein O3 Regulated Protein [14]
Methylsterol monooxygenase 1 Regulated Protein [9]
Myocyte-specific enhancer factor 2C Regulated Protein [32]
Myosin regulatory light polypeptide 9 Regulated Protein [33]
Nuclear factor 1 A-type Regulated Protein [34]
Nuclear factor 1 X-type Regulated Protein [35]
Paired box protein Pax-6 Regulated Protein [36]
Phosphatidate cytidylyltransferase 1 Regulated Protein [9]
Polypyrimidine tract-binding protein 2 Regulated Protein [37]
PR domain zinc finger protein 1 Regulated Protein [38]
Protein ECT2 Regulated Protein [39]
Protein ZNF365 Regulated Protein [9]
Rho-related GTP-binding protein RhoB Regulated Protein [35]
Selenocysteine insertion sequence-binding protein 2-like Regulated Protein [9]
Semaphorin-3A Regulated Protein [5]
Sorting nexin-24 Regulated Protein [9]
SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily D member 1 Regulated Protein [3]
T-cell acute lymphocytic leukemia protein 1 Regulated Protein [42]
Thymocyte selection-associated high mobility group box protein TOX Regulated Protein [43]
Transcription factor MafB Regulated Protein [44]
Transcription factor Sp3 Regulated Protein [21]
Twinfilin-1 Regulated Protein [9]
Zinc finger E-box-binding homeobox 1 Regulated Protein [46]
References
REF 1 MiR-223 suppresses cell proliferation by targeting IGF-1R. PLoS One. 2011;6(11):e27008.
REF 2 MiR-223 modulates multidrug resistance via downregulation of ABCB1 in hepatocellular carcinoma cells. Exp Biol Med (Maywood). 2013 Sep;238(9):1024-32.
REF 3 MicroRNA 223 is upregulated in the multistep progression of Barrett's esophagus and modulates sensitivity to chemotherapy by targeting PARP1. Clin Cancer Res. 2013 Aug 1;19(15):4067-78.
REF 4 MicroRNA-223 controls susceptibility to tuberculosis by regulating lung neutrophil recruitment. J Clin Invest. 2013 Nov;123(11):4836-48.
REF 5 Exosomal miR-223 Contributes to Mesenchymal Stem Cell-Elicited Cardioprotection in Polymicrobial Sepsis. Sci Rep. 2015 Sep 8;5:13721.
REF 6 Regulation of cystic fibrosis transmembrane conductance regulator by microRNA-145, -223, and -494 is altered in F508 cystic fibrosis airway epithelium. J Immunol. 2013 Apr 1;190(7):3354-62.
REF 7 miR-223 functions as a potent tumor suppressor of the Lewis lung carcinoma cell line by targeting insulin-like growth factor-1 receptor and cyclin-... Oncol Lett. 2013 Aug;6(2):359-366.
REF 8 MicroRNA-223 enhances radiation sensitivity of U87MG cells in vitro and in vivo by targeting ataxia telangiectasia mutated. Int J Radiat Oncol Biol Phys. 2014 Mar 15;88(4):955-60.
REF 9 MicroRNA profiling in mucosal biopsies of eosinophilic esophagitis patients pre and post treatment with steroids and relationship with mRNA targets. PLoS One. 2012;7(7):e40676.
REF 10 Heat shock protein 90B1 plays an oncogenic role and is a target of microRNA-223 in human osteosarcoma. Cell Physiol Biochem. 2012;30(6):1481-90.
REF 11 MicroRNA-223 regulates Glut4 expression and cardiomyocyte glucose metabolism. Cardiovasc Res. 2010 Jun 1;86(3):410-20.
REF 12 Cell-cycle regulator E2F1 and microRNA-223 comprise an autoregulatory negative feedback loop in acute myeloid leukemia. Blood. 2010 Mar 4;115(9):1768-78.
REF 13 The RNA-binding protein Tristetraprolin (TTP) is a critical negative regulator of the NLRP3 inflammasome. J Biol Chem. 2017 Apr 28;292(17):6869-6881.
REF 14 Decoy oligonucleotide rescues IGF1R expression from MicroRNA-223 suppression. PLoS One. 2013 Dec 4;8(12):e82167.
REF 15 STAT1: A Novel Target of miR-150 and miR-223 Is Involved in the Proliferation of HTLV-I-Transformed and ATL Cells. Neoplasia. 2015 May;17(5):449-62.
REF 16 MicroRNAs modulate the noncanonical transcription factor NF-kappaB pathway by regulating expression of the kinase IKKalpha during macrophage differentiation. Nat Immunol. 2010 Sep;11(9):799-805.
REF 17 PRMT4 blocks myeloid differentiation by assembling a methyl-RUNX1-dependent repressor complex. Cell Rep. 2013 Dec 26;5(6):1625-38.
REF 18 MicroRNA-223 regulates FOXO1 expression and cell proliferation. FEBS Lett. 2012 Apr 5;586(7):1038-43.
REF 19 MicroRNA-223 functions as an oncogene in human gastric cancer by targeting FBXW7/hCdc4. J Cancer Res Clin Oncol. 2012 May;138(5):763-74.
REF 20 Micro RNA 145 targets the insulin receptor substrate-1 and inhibits the growth of colon cancer cells. J Biol Chem. 2007 Nov 9;282(45):32582-90.
REF 21 Interplay between HIV-1 infection and host microRNAs. Nucleic Acids Res. 2012 Mar;40(5):2181-96.
REF 22 MicroRNA-223 reversibly regulates erythroid and megakaryocytic differentiation of K562 cells. J Cell Mol Med. 2009 Nov-Dec;13(11-12):4551-9.
REF 23 MicroRNAs 185, 96, and 223 repress selective high-density lipoprotein cholesterol uptake through posttranscriptional inhibition. Mol Cell Biol. 2013 May;33(10):1956-64.
REF 24 MicroRNA-223 Increases the Sensitivity of Triple-Negative Breast Cancer Stem Cells to TRAIL-Induced Apoptosis by Targeting HAX-1. PLoS One. 2016 Sep 12;11(9):e0162754.
REF 25 MicroRNA-223 is commonly repressed in hepatocellular carcinoma and potentiates expression of Stathmin1. Gastroenterology. 2008 Jul;135(1):257-69.
REF 26 miR-223 regulates migration and invasion by targeting Artemin in human esophageal carcinoma.J Biomed Sci. 2011 Mar 31;18:24.
REF 27 miRNA-223 promotes gastric cancer invasion and metastasis by targeting tumor suppressor EPB41L3.Mol Cancer Res. 2011 Jul;9(7):824-33.
REF 28 Caprin-1 is a novel microRNA-223 target for regulating the proliferation and invasion of human breast cancer cells.Biomed Pharmacother. 2013 Sep;67(7):629-36.
REF 29 Decoy oligonucleotide rescues IGF1R expression from MicroRNA-223 suppression. PLoS One. 2013 Dec 4;8(12):e82167.
REF 30 Regulation of cytochrome b5 expression by miR-223 in human liver: effects on cytochrome P450 activities.Pharm Res. 2014 Mar;31(3):780-94.
REF 31 MicroRNA profiling in mucosal biopsies of eosinophilic esophagitis patients pre and post treatment with steroids and relationship with mRNA targets. PLoS One. 2012;7(7):e40676.
REF 32 Regulation of progenitor cell proliferation and granulocyte function by microRNA-223.Nature. 2008 Feb 28;451(7182):1125-9.
REF 33 MicroRNA-223 Attenuates Hypoxia-induced Vascular Remodeling by Targeting RhoB/MLC2 in Pulmonary Arterial Smooth Muscle Cells.Sci Rep. 2016 Apr 28;6:24900.
REF 34 Epigenetic silencing of the myelopoiesis regulator microRNA-223 by the AML1/ETO oncoprotein.Cancer Cell. 2007 Nov;12(5):457-66.
REF 35 Sequence context outside the target region influences the effectiveness of miR-223 target sites in the RhoB 3'UTR.Nucleic Acids Res. 2010 Jan;38(1):239-52.
REF 36 microRNA-223 promotes the growth and invasion of glioblastoma cells by targeting tumor suppressor PAX6.Oncol Rep. 2013 Nov;30(5):2263-9.
REF 37 BCR-ABL mediated repression of miR-223 results in the activation of MEF2C and PTBP2 in chronic myeloid leukemia.Leukemia. 2013 Jul;27(7):1578-80.
REF 38 The downregulation of PRDM1/Blimp-1 is associated with aberrant expression of miR-223 in extranodal NK/T-cell lymphoma, nasal type.J Exp Clin Cancer Res. 2014 Jan 17;33:7.
REF 39 MiR-223/Ect2/p21 signaling regulates osteosarcoma cell cycle progression and proliferation.Biomed Pharmacother. 2013 Jun;67(5):381-6.
REF 40 Exosomal miR-223 Contributes to Mesenchymal Stem Cell-Elicited Cardioprotection in Polymicrobial Sepsis. Sci Rep. 2015 Sep 8;5:13721.
REF 41 MicroRNA 223 is upregulated in the multistep progression of Barrett's esophagus and modulates sensitivity to chemotherapy by targeting PARP1. Clin Cancer Res. 2013 Aug 1;19(15):4067-78.
REF 42 The TAL1 complex targets the FBXW7 tumor suppressor by activating miR-223 in human T cell acute lymphoblastic leukemia.J Exp Med. 2013 Jul 29;210(8):1545-57.
REF 43 miR-223 regulates cell growth and targets proto-oncogenes in mycosis fungoides/cutaneous T-cell lymphoma.J Invest Dermatol. 2014 Apr;134(4):1101-1107.
REF 44 MiR-223 targeting MAFB suppresses proliferation and migration of nasopharyngeal carcinoma cells.BMC Cancer. 2015 Jun 9;15:461.
REF 45 Interplay between HIV-1 infection and host microRNAs. Nucleic Acids Res. 2012 Mar;40(5):2181-96.
REF 46 Ginkgolide B Inhibits Human Bladder Cancer Cell Migration and Invasion Through MicroRNA-223-3p. Cell Physiol Biochem. 2016;39(5):1787-1794.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.