Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T82467 |
Target Info
|
| Target Name |
ATPase family AAA domain containing 2 (ATAD2) |
| Synonyms |
PRO2000; L16; ATPase family AAA domain-containing protein 2; ANCCA; AAA nuclear coregulator cancer-associated protein |
| Target Type |
Literature-reported Target |
| Gene Name |
ATAD2 |
| Biochemical Class |
Acid anhydride hydrolase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-372-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
aaagugcugcgacauuugagcgu
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-372 suppressed the expression of ATAD2, which was highly expressed in HCC and exerted a proto-oncogene effect in hepatic carcinogenesis. |
[1] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Immunohistochemistry; Luciferase Reporter Assay; Western Blot |
[1] |
| Representative Target(s) Regulated by This miRNA |
ATPase family AAA domain containing 2 (ATAD2)
|
Target Info
|
|
|
B-cell translocation gene 1 protein (BTG1)
|
Target Info
|
|
| References |
Top |
| REF 1 |
miR-372 down-regulates the oncogene ATAD2 to influence hepatocellular carcinoma proliferation and metastasis. BMC Cancer. 2014 Feb 19;14:107.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
