Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T83904 |
Target Info
|
| Target Name |
NAD-dependent deacetylase sirtuin-2 (SIRT2) |
| Synonyms |
SIR2like protein 2; SIR2L2; SIR2L; SIR2-like protein 2; Regulatory protein SIR2 homolog 2; NADdependent protein deacetylase sirtuin2; NAD-dependent protein deacetylase sirtuin-2 |
| Target Type |
Patented-recorded Target |
| Gene Name |
SIRT2 |
| Biochemical Class |
Carbon-nitrogen hydrolase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-21-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uagcuuaucagacugauguuga
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
SIRT2 deacetylated p65 at K310 and blocked p65 binding to the promoter region of miR-21, thus regressing the transcription of miR-21. |
[2] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Literature Reported |
[1] |
| 2 |
Western Blot |
[2] |
| Representative Target(s) Regulated by This miRNA |
Apoptosis antigen ligand (CD178)
|
Target Info
|
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
| References |
Top |
| REF 1 |
Targeting strategies on miRNA-21 and PDCD4 for glioblastoma. Arch Biochem Biophys. 2015 Aug 15;580:64-74.
|
| REF 2 |
Sirt2 suppresses glioma cell growth through targeting NF-B-miR-21 axis. Biochem Biophys Res Commun. 2013 Nov 22;441(3):661-7.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
