miRNA Details

miRNA General Information
miRNA Mature ID hsa-miR-21-5p
miRNA Stemloop AC MI0000077
miRNA Stemloop ID hsa-mir-21
Sequence uagcuuaucagacugauguuga
TTD Target(s) Regulated by This miRNA Epidermal growth factor receptor (EGFR) Successful Target Target Info [1]
Erbb2 tyrosine kinase receptor (HER2) Successful Target Target Info [2]
Matrix metalloproteinase-2 (MMP-2) Successful Target Target Info [3]
Cyclin-dependent kinase 6 (CDK6) Successful Target Target Info [4]
Insulin-like growth factor I receptor (IGF1R) Successful Target Target Info [5]
Multidrug resistance protein 1 (ABCB1) Clinical trial Target Target Info [6]
Peroxisome proliferator-activated receptor alpha (PPARA) Successful Target Target Info [7]
Apoptosis regulator Bcl-2 (BCL-2) Successful Target Target Info [8]
Interleukin-1 beta (IL1B) Successful Target Target Info [9]
Interleukin-12 alpha (IL12A) Successful Target Target Info [10]
Signal transducer and activator of transcription 3 (STAT3) Successful Target Target Info [1]
Tissue-type plasminogen activator (PLAT) Successful Target Target Info [9]
Intercellular adhesion molecule ICAM-1 (ICAM1) Successful Target Target Info [9]
Transforming growth factor beta 1 (TGFB1) Successful Target Target Info [11]
Vascular endothelial growth factor A (VEGFA) Successful Target Target Info [3]
Oxytocin receptor (OTR) Successful Target Target Info [12]
Matrix metalloproteinase-9 (MMP-9) Clinical trial Target Target Info [3]
C-C chemokine receptor type 1 (CCR1) Clinical trial Target Target Info [9]
Growth/differentiation factor 5 (GDF-5) Clinical trial Target Target Info [13]
Toll-like receptor 3 (TLR3) Clinical trial Target Target Info [14]
TRAIL receptor 2 (TRAIL-R2) Clinical trial Target Target Info [15]
Transforming growth factor beta 2 (TGFB2) Clinical trial Target Target Info [11]
C-X-C motif chemokine 10 (CXCL10) Clinical trial Target Target Info [16]
TGF-beta receptor type II (TGFBR2) Clinical trial Target Target Info [17]
Mesothelin (MSLN) Clinical trial Target Target Info [18]
B7-related protein 1 (B7RP1) Clinical trial Target Target Info [14]
E2F transcription factor 1 (E2F1) Clinical trial Target Target Info [19]
Liver and activation-regulated chemokine (CCL20) Clinical trial Target Target Info [20]
Reticulon-4 (RTN4) Clinical trial Target Target Info [21]
Survival motor neuron protein (SMN1) Successful Target Target Info [22]
Myristoylated alanine-rich C-kinase substrate (MARCKS) Clinical trial Target Target Info [23]
Transcription factor Sp1 (SP1) Clinical trial Target Target Info [24]
Caspase-8 (CASP8) Patented-recorded Target Target Info [25]
IL-1 receptor-associated kinase 1 (IRAK1) Patented-recorded Target Target Info [26]
Myeloid differentiation primary response protein MyD88 (MYD88) Literature-reported Target Target Info [26]
von Hippel-Lindau disease tumor suppressor (VHL) Patented-recorded Target Target Info [27]
Neurotrophin-3 (NTF3) Discontinued Target Target Info [28]
M-phase inducer phosphatase 1 (MPIP1) Literature-reported Target Target Info [29]
Nuclear receptor coactivator 3 (NCOA3) Literature-reported Target Target Info [30]
Bone morphogenetic protein receptor (BMPR2) Literature-reported Target Target Info [31]
HIF-prolyl hydroxylase 2 (HPH-2) Patented-recorded Target Target Info [32]
LDL receptor related protein-6 (LRP-6) Clinical trial Target Target Info [33]
NAD-dependent deacetylase sirtuin-2 (SIRT2) Patented-recorded Target Target Info [34]
Phosphatase and tensin homolog (PTEN) Literature-reported Target Target Info [35]
Proto-oncogene c-Myc (MYC) Literature-reported Target Target Info [30]
RAC-beta serine/threonine-protein kinase (AKT2) Literature-reported Target Target Info [1]
Rhodopsin (RHO) Literature-reported Target Target Info [36]
S-methyl-5'-thioadenosine phosphorylase (MTAP) Literature-reported Target Target Info [37]
Dual specificity protein phosphatase 10 (DUSP10) Literature-reported Target Target Info [38]
Lysine N-methyltransferase 3A (SETD2) Literature-reported Target Target Info [39]
Maspin (SERPINB5) Literature-reported Target Target Info [40]
Mitotic growth and transcription activator (BAF190A) Literature-reported Target Target Info [41]
Protein-tyrosine phosphatase pez (PTPN14) Literature-reported Target Target Info [1]
Rotamase F (PPIF) Literature-reported Target Target Info [11]
Ubiquitin thioesterase OTU1 (YOD1) Literature-reported Target Target Info [11]
Zinc finger protein A20 (TNFAIP3) Literature-reported Target Target Info [9]
Apoptosis antigen ligand (CD178) Literature-reported Target Target Info [42]
CCAAT/enhancer binding protein beta (CEBPB) Literature-reported Target Target Info [14]
Forkhead box protein O1A (FOXO1) Literature-reported Target Target Info [43]
High mobility group protein B1 (HMGB1) Literature-reported Target Target Info [14]
Polycomb complex protein BMI-1 (BMI1) Clinical trial Target Target Info [44]
DNA mismatch repair protein MSH2 (MSH2) Literature-reported Target Target Info [11]
GTPase activating protein (RASA1) Literature-reported Target Target Info [45]
Melanoma differentiation-associated protein 6 (CDKN1A) Literature-reported Target Target Info [31]
T-lymphoma invasion and metastasis 1 (TIAM1) Literature-reported Target Target Info [46]
Transcription factor E2F2 (E2F2) Literature-reported Target Target Info [30]
Transcription factor SOX-2 (SOX2) Literature-reported Target Target Info [11]
Vitiligo-associated protein 1 (FBXO11) Literature-reported Target Target Info [11]
Clusterin (CLU) Literature-reported Target Target Info [47]
Suppressor of cytokine signaling 1 (SOCS1) Literature-reported Target Target Info [48]
Suppressor of tumorigenicity 15 protein (ST15) Literature-reported Target Target Info [11]
Transcription factor SOX-5 (SOX5) Literature-reported Target Target Info [37]
Protein(s) Regulated by This miRNA 15-hydroxyprostaglandin dehydrogenase [NAD(+)] Regulated Protein
PGDH_HUMAN
[49]
26S proteasome non-ATPase regulatory subunit 9 Regulated Protein
PSMD9_HUMAN
[50]
40S ribosomal protein S7 Regulated Protein
RS7_HUMAN
[21]
Acidic leucine-rich nuclear phosphoprotein 32 family member A Regulated Protein
AN32A_HUMAN
[41]
Ankyrin repeat domain-containing protein 46 Regulated Protein
ANR46_HUMAN
[53]
Antigen peptide transporter 1 Regulated Protein
TAP1_HUMAN
[14]
Apoptosis-stimulating of p53 protein 2 Regulated Protein
ASPP2_HUMAN
[55]
Apoptotic protease-activating factor 1 Regulated Protein
APAF_HUMAN
[55]
B-cell lymphoma 6 protein Regulated Protein
BCL6_HUMAN
[56]
B-cell lymphoma/leukemia 10 Regulated Protein
BCL10_HUMAN
[14]
Brain acid soluble protein 1 Regulated Protein
BASP1_HUMAN
[21]
Cell adhesion molecule 1 Regulated Protein
CADM1_HUMAN
[57]
Collagen alpha-1(IV) chain Regulated Protein
CO4A1_HUMAN
[58]
Condensin complex subunit 3 Regulated Protein
CND3_HUMAN
[21]
Cyclin-dependent kinase 2-associated protein 1 Regulated Protein
CDKA1_HUMAN
[59]
Death domain-associated protein 6 Regulated Protein
DAXX_HUMAN
[55]
Dedicator of cytokinesis protein 4 Regulated Protein
DOCK4_HUMAN
[60]
Dedicator of cytokinesis protein 5 Regulated Protein
DOCK5_HUMAN
[60]
Dedicator of cytokinesis protein 7 Regulated Protein
DOCK7_HUMAN
[60]
Derlin-1 Regulated Protein
DERL1_HUMAN
[21]
DNA mismatch repair protein Msh6 Regulated Protein
MSH6_HUMAN
[61]
DNA-binding protein SATB1 Regulated Protein
SATB1_HUMAN
[62]
Dual specificity mitogen-activated protein kinase kinase 3 Regulated Protein
MP2K3_HUMAN
[63]
Dynamin-1-like protein Regulated Protein
DNM1L_HUMAN
[64]
E3 SUMO-protein ligase CBX4 Regulated Protein
CBX4_HUMAN
[14]
E3 SUMO-protein ligase PIAS3 Regulated Protein
PIAS3_HUMAN
[65]
E3 ubiquitin-protein ligase CHIP Regulated Protein
CHIP_HUMAN
[66]
E3 ubiquitin-protein ligase pellino homolog 1 Regulated Protein
PELI1_HUMAN
[10]
E3 ubiquitin-protein ligase rififylin Regulated Protein
RFFL_HUMAN
[10]
E3 ubiquitin-protein ligase Topors Regulated Protein
TOPRS_HUMAN
[55]
E3 ubiquitin-protein ligase TRAF7 Regulated Protein
TRAF7_HUMAN
[25]
E3 ubiquitin-protein transferase RMND5A Regulated Protein
RMD5A_HUMAN
[10]
ELAV-like protein 4 Regulated Protein
ELAV4_HUMAN
[69]
Eukaryotic initiation factor 4A-II Regulated Protein
IF4A2_HUMAN
[53]
Eukaryotic translation initiation factor 2 subunit 1 Regulated Protein
IF2A_HUMAN
[21]
Extracellular superoxide dismutase [Cu-Zn] Regulated Protein
SODE_HUMAN
[70]
Fibromodulin Regulated Protein
FMOD_HUMAN
[71]
Forkhead box protein P3 Regulated Protein
FOXP3_HUMAN
[72]
Frizzled-6 Regulated Protein
FZD6_HUMAN
[73]
Heterogeneous nuclear ribonucleoprotein K Regulated Protein
HNRPK_HUMAN
[55]
Homeobox protein TGIF1 Regulated Protein
TGIF1_HUMAN
[71]
Homeodomain-interacting protein kinase 3 Regulated Protein
HIPK3_HUMAN
[10]
Iron-sulfur cluster assembly enzyme ISCU, mitochondrial Regulated Protein
ISCU_HUMAN
[74]
Junction-mediating and -regulatory protein Regulated Protein
JMY_HUMAN
[55]
Leucine-rich repeat flightless-interacting protein 1 Regulated Protein
LRRF1_HUMAN
[75]
Metalloproteinase inhibitor 3 Regulated Protein
TIMP3_HUMAN
[11]
Multifunctional procollagen lysine hydroxylase and glycosyltransferase LH3 Regulated Protein
PLOD3_HUMAN
[21]
Myocyte-specific enhancer factor 2C Regulated Protein
MEF2C_HUMAN
[77]
N(G),N(G)-dimethylarginine dimethylaminohydrolase 1 Regulated Protein
DDAH1_HUMAN
[78]
Neuron navigator 3 Regulated Protein
NAV3_HUMAN
[79]
Neuroserpin Regulated Protein
NEUS_HUMAN
[80]
Nuclear factor 1 A-type Regulated Protein
NFIA_HUMAN
[81]
Nuclear factor 1 B-type Regulated Protein
NFIB_HUMAN
[82]
Partner of Y14 and mago Regulated Protein
PYM1_HUMAN
[21]
Pentraxin-related protein PTX3 Regulated Protein
PTX3_HUMAN
[9]
Phosphatidylinositol 3-kinase regulatory subunit alpha Regulated Protein
P85A_HUMAN
[84]
Poly(rC)-binding protein 1 Regulated Protein
PCBP1_HUMAN
[21]
Polycomb group RING finger protein 2 Regulated Protein
PCGF2_HUMAN
[85]
Programmed cell death protein 4 Regulated Protein
PDCD4_HUMAN
[86]
Prostaglandin G/H synthase 2 Regulated Protein
PGH2_HUMAN
[87]
Protein BTG2 Regulated Protein
BTG2_HUMAN
[88]
Protein CASC2, isoforms 1/2 Regulated Protein
CASC2_HUMAN
[89]
Protein jagged-1 Regulated Protein
JAG1_HUMAN
[90]
Protein sprouty homolog 2 Regulated Protein
SPY2_HUMAN
[91]
Pyruvate dehydrogenase E1 component subunit alpha, testis-specific form, mitochondrial Regulated Protein
ODPAT_HUMAN
[21]
RAS guanyl-releasing protein 1 Regulated Protein
GRP1_HUMAN
[92]
RE1-silencing transcription factor Regulated Protein
REST_HUMAN
[93]
Rho-related GTP-binding protein RhoB Regulated Protein
RHOB_HUMAN
[94]
SAM and SH3 domain-containing protein 1 Regulated Protein
SASH1_HUMAN
[10]
Selenocysteine insertion sequence-binding protein 2-like Regulated Protein
SBP2L_HUMAN
[10]
SPATS2-like protein Regulated Protein
SPS2L_HUMAN
[21]
Suppressor of cytokine signaling 6 Regulated Protein
SOCS6_HUMAN
[48]
TIR domain-containing adapter molecule 2 Regulated Protein
TCAM2_HUMAN
[14]
Torsin-1A-interacting protein 2 Regulated Protein
TOIP2_HUMAN
[10]
Transcription factor 21 Regulated Protein
TCF21_HUMAN
[96]
Transforming growth factor beta receptor type 3 Regulated Protein
TGBR3_HUMAN
[55]
Transforming growth factor-beta-induced protein ig-h3 Regulated Protein
BGH3_HUMAN
[97]
Transmembrane 9 superfamily member 3 Regulated Protein
TM9S3_HUMAN
[21]
Tropomyosin alpha-1 chain Regulated Protein
TPM1_HUMAN
[98]
Tumor protein 63 Regulated Protein
P63_HUMAN
[55]
Ubiquitin-conjugating enzyme E2 N Regulated Protein
UBE2N_HUMAN
[14]
Wolframin Regulated Protein
WFS1_HUMAN
[21]
References
REF 1 Downregulation of miR-21 inhibits EGFR pathway and suppresses the growth of human glioblastoma cells independent of PTEN status. Lab Invest. 2010 Feb;90(2):144-55.
REF 2 Up-regulation of miR-21 by HER2/neu signaling promotes cell invasion. J Biol Chem. 2009 Jul 3;284(27):18515-24.
REF 3 MicroRNA-21 modulates biological functions of pancreatic cancer cells including their proliferation, invasion, and chemoresistance. Mol Cancer Ther. 2009 May;8(5):1067-74.
REF 4 Physiological identification of human transcripts translationally regulated by a specific microRNA. Hum Mol Genet. 2005 Dec 15;14(24):3813-21.
REF 5 Modulation of microRNAs in hypertension-induced arterial remodeling through the 1 and 3-adrenoreceptor pathways. J Mol Cell Cardiol. 2013 Dec;65:127-36.
REF 6 Antagonism of miRNA-21 Sensitizes Human Gastric Cancer Cells to Paclitaxel. Cell Biochem Biophys. 2015 May;72(1):275-82.
REF 7 Michael T. McManus: Interrupting biology [interview by Hema Bashyam]. J Exp Med. 2008 Mar 17;205(3):506-7.
REF 8 miR-21-mediated tumor growth. Oncogene. 2007 Apr 26;26(19):2799-803.
REF 9 Induction of miR-21 by retinoic acid in estrogen receptor-positive breast carcinoma cells: biological correlates and molecular targets. J Biol Chem. 2011 Feb 4;286(5):4027-42.
REF 10 MicroRNA profiling in mucosal biopsies of eosinophilic esophagitis patients pre and post treatment with steroids and relationship with mRNA targets. PLoS One. 2012;7(7):e40676.
REF 11 MicroRNA 21 promotes glioma invasion by targeting matrix metalloproteinase regulators. Mol Cell Biol. 2008 Sep;28(17):5369-80.
REF 12 Hypomethylation of miR-142 promoter and upregulation of microRNAs that target the oxytocin receptor gene in the autism prefrontal cortex. Mol Autism. 2015 Aug 14;6:46.
REF 13 MicroRNA-21 controls the development of osteoarthritis by targeting GDF-5 in chondrocytes. Exp Mol Med. 2014 Feb 28;46:e79.
REF 14 Regulation of NF-B signaling by oxidized glycerophospholipid and IL-1 induced miRs-21-3p and -27a-5p in human aortic endothelial cells. J Lipid Res. 2015 Jan;56(1):38-50.
REF 15 Regulation of the extrinsic apoptotic pathway by microRNA-21 in alcoholic liver injury. J Biol Chem. 2014 Oct 3;289(40):27526-39.
REF 16 Pseudorabies viral replication is inhibited by a novel target of miR-21. Virology. 2014 May;456-457:319-28.
REF 17 A microRNA expression signature of human solid tumors defines cancer gene targets. Proc Natl Acad Sci U S A. 2006 Feb 14;103(7):2257-61.
REF 18 Identification of MiR-21-5p as a Functional Regulator of Mesothelin Expression Using MicroRNA Capture Affinity Coupled with Next Generation Sequencing. PLoS One. 2017 Jan 26;12(1):e0170999.
REF 19 c-Myc-regulated microRNAs modulate E2F1 expression. Nature. 2005 Jun 9;435(7043):839-43.
REF 20 MiR-21 is involved in cervical squamous cell tumorigenesis and regulates CCL20. Biochim Biophys Acta. 2012 Feb;1822(2):248-60.
REF 21 Identification of miR-21 targets in breast cancer cells using a quantitative proteomic approach. Proteomics. 2009 Mar;9(5):1374-84.
REF 22 MicroRNA-21 in scleroderma fibrosis and its function in TGF--regulated fibrosis-related genes expression. J Clin Immunol. 2013 Aug;33(6):1100-9.
REF 23 MicroRNA-21 directly targets MARCKS and promotes apoptosis resistance and invasion in prostate cancer cells. Biochem Biophys Res Commun. 2009 Jun 5;383(3):280-5.
REF 24 MicroRNA-21 represses human cystathionine gamma-lyase expression by targeting at specificity protein-1 in smooth muscle cells. J Cell Physiol. 2012 Sep;227(9):3192-200.
REF 25 A set of NF-B-regulated microRNAs induces acquired TRAIL resistance in lung cancer. Proc Natl Acad Sci U S A. 2015 Jun 30;112(26):E3355-64.
REF 26 HCV-induced miR-21 contributes to evasion of host immune system by targeting MyD88 and IRAK1. PLoS Pathog. 2013;9(4):e1003248.
REF 27 Blockage of a miR-21/EGFR regulatory feedback loop augments anti-EGFR therapy in glioblastomas. Cancer Lett. 2014 Jan 1;342(1):139-49.
REF 28 Neurotrophin-3 mRNA a putative target of miR21 following status epilepticus. Brain Res. 2011 Nov 18;1424:53-9.
REF 29 The let-7 microRNA represses cell proliferation pathways in human cells. Cancer Res. 2007 Aug 15;67(16):7713-22.
REF 30 Estradiol-regulated microRNAs control estradiol response in breast cancer cells. Nucleic Acids Res. 2009 Aug;37(14):4850-61.
REF 31 Programmed cell death 4 (PDCD4) is an important functional target of the microRNA miR-21 in breast cancer cells. J Biol Chem. 2008 Jan 11;283(2):1026-33.
REF 32 miR-21 contributes to renal protection by targeting prolyl hydroxylase domain protein 2 in delayed ischaemic preconditioning. Nephrology (Carlton). 2017 May;22(5):366-373.
REF 33 Mutation of miR-21 targets endogenous lipoprotein receptor-related protein 6 and nonalcoholic fatty liver disease. Am J Transl Res. 2017 Feb 15;9(2):715-721.
REF 34 Sirt2 suppresses glioma cell growth through targeting NF-B-miR-21 axis. Biochem Biophys Res Commun. 2013 Nov 22;441(3):661-7.
REF 35 Prediction of mammalian microRNA targets. Cell. 2003 Dec 26;115(7):787-98.
REF 36 Targeting miR-21 inhibits in vitro and in vivo multiple myeloma cell growth. Clin Cancer Res. 2013 Apr 15;19(8):2096-106.
REF 37 MicroRNA-21 down-regulates the expression of tumor suppressor PDCD4 in human glioblastoma cell T98G. Cancer Lett. 2008 Dec 18;272(2):197-205.
REF 38 Downregulation of inflammatory microRNAs by Ig-like transcript 3 is essential for the differentiation of human CD8(+) T suppressor cells. J Immunol. 2012 Apr 1;188(7):3042-52.
REF 39 A feedback regulatory loop between HIF-1 and miR-21 in response to hypoxia in cardiomyocytes. FEBS Lett. 2014 Aug 25;588(17):3137-46.
REF 40 MicroRNA-21 targets tumor suppressor genes in invasion and metastasis. Cell Res. 2008 Mar;18(3):350-9.
REF 41 MicroRNA-21 targets tumor suppressor genes ANP32A and SMARCA4. Oncogene. 2011 Jun 30;30(26):2975-85.
REF 42 Foxo3a regulates apoptosis by negatively targeting miR-21. J Biol Chem. 2010 May 28;285(22):16958-66.
REF 43 MicroRNA-21 plays an oncogenic role by targeting FOXO1 and activating the PI3K/AKT pathway in diffuse large B-cell lymphoma. Oncotarget. 2015 Jun 20;6(17):15035-49.
REF 44 Bmi-1 regulates stem cell-like properties of gastric cancer cells via modulating miRNAs. J Hematol Oncol. 2016 Sep 20;9(1):90.
REF 45 MiR-21/RASA1 axis affects malignancy of colon cancer cells via RAS pathways. World J Gastroenterol. 2015 Feb 7;21(5):1488-97.
REF 46 miR-21 and miR-31 converge on TIAM1 to regulate migration and invasion of colon carcinoma cells. J Biol Chem. 2010 Nov 12;285(46):35293-302.
REF 47 Clusterin is a gene-specific target of microRNA-21 in head and neck squamous cell carcinoma. Clin Cancer Res. 2014 Feb 15;20(4):868-77.
REF 48 MiR-21 and MiR-155 promote non-small cell lung cancer progression by downregulating SOCS1, SOCS6, and PTEN. Oncotarget. 2016 Dec 20;7(51):84508-84519.
REF 49 miR-21 targets 15-PGDH and promotes cholangiocarcinoma growth.Mol Cancer Res. 2014 Jun;12(6):890-900.
REF 50 Celastrol induces cell cycle arrest by MicroRNA-21-mTOR-mediated inhibition p27 protein degradation in gastric cancer.Cancer Cell Int. 2015 Oct 24;15:101.
REF 51 Identification of miR-21 targets in breast cancer cells using a quantitative proteomic approach. Proteomics. 2009 Mar;9(5):1374-84.
REF 52 MicroRNA-21 targets tumor suppressor genes ANP32A and SMARCA4. Oncogene. 2011 Jun 30;30(26):2975-85.
REF 53 Knockdown of miR-21 in human breast cancer cell lines inhibits proliferation, in vitro migration and in vivo tumor growth.Breast Cancer Res. 2011 Jan 10;13(1):R2.
REF 54 Regulation of NF-B signaling by oxidized glycerophospholipid and IL-1 induced miRs-21-3p and -27a-5p in human aortic endothelial cells. J Lipid Res. 2015 Jan;56(1):38-50.
REF 55 MicroRNA-21 targets a network of key tumor-suppressive pathways in glioblastoma cells. Cancer Res. 2008 Oct 1;68(19):8164-72.
REF 56 The Bcl6 target gene microRNA-21 promotes Th2 differentiation by a T cell intrinsic pathway.Mol Immunol. 2013 Jul;54(3-4):435-42.
REF 57 MYCN-mediated miR-21 overexpression enhances chemo-resistance via targeting CADM1 in tongue cancer.J Mol Med (Berl). 2016 Oct;94(10):1129-1141.
REF 58 MiR-21 is enriched in the RNA-induced silencing complex and targets COL4A1 in human granulosa cell lines.Reprod Sci. 2012 Oct;19(10):1030-40.
REF 59 miR-21 downregulates the tumor suppressor P12 CDK2AP1 and stimulates cell proliferation and invasion.J Cell Biochem. 2011 Mar;112(3):872-80.
REF 60 Bone morphogenetic protein 4 promotes vascular smooth muscle contractility by activating microRNA-21 (miR-21), which down-regulates expression of family of dedicator of cytokinesis (DOCK) proteins.J Biol Chem. 2012 Feb 3;287(6):3976-86.
REF 61 MicroRNA-21 induces resistance to 5-fluorouracil by down-regulating human DNA MutS homolog 2 (hMSH2). Proc Natl Acad Sci U S A. 2010 Dec 7;107(49):21098-103.
REF 62 miR-21 regulates chronic hypoxia-induced pulmonary vascular remodeling. Am J Physiol Lung Cell Mol Physiol. 2012 Mar 15;302(6):L521-9.
REF 63 MicroRNA-21 promotes hepatocellular carcinoma HepG2 cell proliferation through repression of mitogen-activated protein kinase-kinase 3.BMC Cancer. 2013 Oct 10;13:469.
REF 64 miR-21-5p/203a-3p promote ox-LDL-induced endothelial cell senescence through down-regulation of mitochondrial fission protein Drp1.Mech Ageing Dev. 2017 Jun;164:8-19.
REF 65 Identification of novel miR-21 target proteins in multiple myeloma cells by quantitative proteomics.J Proteome Res. 2012 Apr 6;11(4):2078-90.
REF 66 Human Stem Cells Overexpressing miR-21 Promote Angiogenesis in Critical Limb Ischemia by Targeting CHIP to Enhance HIF-1 Activity.Stem Cells. 2016 Apr;34(4):924-34.
REF 67 MicroRNA profiling in mucosal biopsies of eosinophilic esophagitis patients pre and post treatment with steroids and relationship with mRNA targets. PLoS One. 2012;7(7):e40676.
REF 68 A set of NF-B-regulated microRNAs induces acquired TRAIL resistance in lung cancer. Proc Natl Acad Sci U S A. 2015 Jun 30;112(26):E3355-64.
REF 69 miR-375 inhibits differentiation of neurites by lowering HuD levels.Mol Cell Biol. 2010 Sep;30(17):4197-210.
REF 70 MicroRNA-21 modulates the levels of reactive oxygen species by targeting SOD3 and TNF.Cancer Res. 2012 Sep 15;72(18):4707-13.
REF 71 microRNA 21: response to hormonal therapies and regulatory function in leiomyoma, transformed leiomyoma and leiomyosarcoma cells. Mol Hum Reprod. 2010 Mar;16(3):215-27.
REF 72 MicroRNA-21 negatively regulates Treg cells through a TGF-1/Smad-independent pathway in patients with coronary heart disease. Cell Physiol Biochem. 2015;37(3):866-78.
REF 73 FZD6, targeted by miR-21, represses gastric cancer cell proliferation and migration via activating non-canonical wnt pathway. Am J Transl Res. 2016 May 15;8(5):2354-64.
REF 74 MicroRNA-21 is involved in osteosarcoma cell invasion and migration. Med Oncol. 2011 Dec;28(4):1469-74.
REF 75 MicroRNA-21 targets LRRFIP1 and contributes to VM-26 resistance in glioblastoma multiforme.Brain Res. 2009 Aug 25;1286:13-8.
REF 76 MicroRNA 21 promotes glioma invasion by targeting matrix metalloproteinase regulators. Mol Cell Biol. 2008 Sep;28(17):5369-80.
REF 77 MicroRNA-21 dysregulates the expression of MEF2C in neurons in monkey and human SIV/HIV neurological disease.Cell Death Dis. 2010;1:e77.
REF 78 MicroRNA21 promotes interstitial fibrosis via targeting DDAH1: a potential role in renal fibrosis.Mol Cell Biochem. 2016 Jan;411(1-2):181-9.
REF 79 The passenger strand, miR-21-3p, plays a role in mediating cisplatin resistance in ovarian cancer cells.Gynecol Oncol. 2015 Apr;137(1):143-51.
REF 80 MicroRNA-21 inhibits Serpini1, a gene with novel tumour suppressive effects in gastric cancer.Dig Liver Dis. 2012 Jul;44(7):589-96.
REF 81 MicroRNA 21 (miR-21) and miR-181b couple with NFI-A to generate myeloid-derived suppressor cells and promote immunosuppression in late sepsis.Infect Immun. 2014 Sep;82(9):3816-25.
REF 82 miR-21 Gene expression triggered by AP-1 is sustained through a double-negative feedback mechanism.J Mol Biol. 2008 May 2;378(3):492-504.
REF 83 Induction of miR-21 by retinoic acid in estrogen receptor-positive breast carcinoma cells: biological correlates and molecular targets. J Biol Chem. 2011 Feb 4;286(5):4027-42.
REF 84 PIK3R1 targeting by miR-21 suppresses tumor cell migration and invasion by reducing PI3K/AKT signaling and reversing EMT, and predicts clinical outcome of breast cancer.Int J Oncol. 2016 Feb;48(2):471-84.
REF 85 Mel-18 negatively regulates stem cell-like properties through downregulation of miR-21 in gastric cancer.Oncotarget. 2016 Sep 27;7(39):63352-63361.
REF 86 MicroRNA-21 (miR-21) post-transcriptionally downregulates tumor suppressor Pdcd4 and stimulates invasion, intravasation and metastasis in colorectal cancer.Oncogene. 2008 Apr 3;27(15):2128-36.
REF 87 miR-21 inhibits the effects of cyclooxygenase-2 inhibitor NS398 on apoptosis and invasion in gastric cancer cells.Onco Targets Ther. 2015 Nov 4;8:3245-53.
REF 88 Regulation of the cell cycle gene, BTG2, by miR-21 in human laryngeal carcinoma.Cell Res. 2009 Jul;19(7):828-37.
REF 89 Long non-coding RNA CASC2 suppresses malignancy in human gliomas by miR-21.Cell Signal. 2015 Feb;27(2):275-82.
REF 90 MicroRNA profiling identifies miR-34a and miR-21 and their target genes JAG1 and WNT1 in the coordinate regulation of dendritic cell differentiation.Blood. 2009 Jul 9;114(2):404-14.
REF 91 MicroRNA-21 targets Sprouty2 and promotes cellular outgrowths.Mol Biol Cell. 2008 Aug;19(8):3272-82.
REF 92 MicroRNA-21 and microRNA-148a contribute to DNA hypomethylation in lupus CD4+ T cells by directly and indirectly targeting DNA methyltransferase 1. J Immunol. 2010 Jun 15;184(12):6773-81.
REF 93 Is REST a regulator of pluripotency Nature. 2009 Feb 26;457(7233):E5-6; discussion E7.
REF 94 Overexpression of miR-21 promotes an in vitro metastatic phenotype by targeting the tumor suppressor RHOB.Mol Cancer Res. 2010 May;8(5):691-700.
REF 95 MiR-21 and MiR-155 promote non-small cell lung cancer progression by downregulating SOCS1, SOCS6, and PTEN. Oncotarget. 2016 Dec 20;7(51):84508-84519.
REF 96 miR-21 downregulated TCF21 to inhibit KISS1 in renal cancer.Urology. 2012 Dec;80(6):1298-302.e1.
REF 97 A single anti-microRNA antisense oligodeoxyribonucleotide (AMO) targeting multiple microRNAs offers an improved approach for microRNA interference.Nucleic Acids Res. 2009 Feb;37(3):e24.
REF 98 MicroRNA-21 targets the tumor suppressor gene tropomyosin 1 (TPM1).J Biol Chem. 2007 May 11;282(19):14328-36.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.