miRNA Details
miRNA General Information | |||||
---|---|---|---|---|---|
miRNA Mature ID | hsa-miR-21-5p | ||||
miRNA Stemloop AC | MI0000077 | ||||
miRNA Stemloop ID | hsa-mir-21 | ||||
Sequence | uagcuuaucagacugauguuga | ||||
TTD Target(s) Regulated by This miRNA | Epidermal growth factor receptor (EGFR) | Successful Target | Target Info | [1] | |
Erbb2 tyrosine kinase receptor (HER2) | Successful Target | Target Info | [2] | ||
Matrix metalloproteinase-2 (MMP-2) | Successful Target | Target Info | [3] | ||
Cyclin-dependent kinase 6 (CDK6) | Successful Target | Target Info | [4] | ||
Insulin-like growth factor I receptor (IGF1R) | Successful Target | Target Info | [5] | ||
Multidrug resistance protein 1 (ABCB1) | Successful Target | Target Info | [6] | ||
Peroxisome proliferator-activated receptor alpha (PPARA) | Successful Target | Target Info | [7] | ||
Apoptosis regulator Bcl-2 (BCL-2) | Successful Target | Target Info | [8] | ||
Interleukin-1 beta (IL1B) | Successful Target | Target Info | [9] | ||
Interleukin-12 alpha (IL12A) | Successful Target | Target Info | [10] | ||
Signal transducer and activator of transcription 3 (STAT3) | Successful Target | Target Info | [1] | ||
Tissue-type plasminogen activator (PLAT) | Successful Target | Target Info | [9] | ||
Intercellular adhesion molecule ICAM-1 (ICAM1) | Successful Target | Target Info | [9] | ||
Transforming growth factor beta 1 (TGFB1) | Successful Target | Target Info | [11] | ||
Vascular endothelial growth factor A (VEGFA) | Successful Target | Target Info | [3] | ||
Oxytocin receptor (OTR) | Successful Target | Target Info | [12] | ||
Matrix metalloproteinase-9 (MMP-9) | Clinical trial Target | Target Info | [3] | ||
C-C chemokine receptor type 1 (CCR1) | Clinical trial Target | Target Info | [9] | ||
Growth/differentiation factor 5 (GDF-5) | Clinical trial Target | Target Info | [13] | ||
Toll-like receptor 3 (TLR3) | Clinical trial Target | Target Info | [14] | ||
TRAIL receptor 2 (TRAIL-R2) | Clinical trial Target | Target Info | [15] | ||
Transforming growth factor beta 2 (TGFB2) | Clinical trial Target | Target Info | [11] | ||
C-X-C motif chemokine 10 (CXCL10) | Clinical trial Target | Target Info | [16] | ||
TGF-beta receptor type II (TGFBR2) | Clinical trial Target | Target Info | [17] | ||
Mesothelin (MSLN) | Clinical trial Target | Target Info | [18] | ||
B7-related protein 1 (B7RP1) | Clinical trial Target | Target Info | [14] | ||
E2F transcription factor 1 (E2F1) | Clinical trial Target | Target Info | [19] | ||
Liver and activation-regulated chemokine (CCL20) | Clinical trial Target | Target Info | [20] | ||
Reticulon-4 (RTN4) | Clinical trial Target | Target Info | [21] | ||
Survival motor neuron protein (SMN1) | Successful Target | Target Info | [22] | ||
Myristoylated alanine-rich C-kinase substrate (MARCKS) | Clinical trial Target | Target Info | [23] | ||
Transcription factor Sp1 (SP1) | Clinical trial Target | Target Info | [24] | ||
Caspase-8 (CASP8) | Patented-recorded Target | Target Info | [25] | ||
IL-1 receptor-associated kinase 1 (IRAK1) | Patented-recorded Target | Target Info | [26] | ||
Myeloid differentiation primary response protein MyD88 (MYD88) | Literature-reported Target | Target Info | [26] | ||
von Hippel-Lindau disease tumor suppressor (VHL) | Patented-recorded Target | Target Info | [27] | ||
Neurotrophin-3 (NTF3) | Discontinued Target | Target Info | [28] | ||
M-phase inducer phosphatase 1 (MPIP1) | Literature-reported Target | Target Info | [29] | ||
Nuclear receptor coactivator 3 (NCOA3) | Literature-reported Target | Target Info | [30] | ||
Bone morphogenetic protein receptor (BMPR2) | Literature-reported Target | Target Info | [31] | ||
HIF-prolyl hydroxylase 2 (HPH-2) | Patented-recorded Target | Target Info | [32] | ||
LDL receptor related protein-6 (LRP-6) | Clinical trial Target | Target Info | [33] | ||
NAD-dependent deacetylase sirtuin-2 (SIRT2) | Patented-recorded Target | Target Info | [34] | ||
Phosphatase and tensin homolog (PTEN) | Literature-reported Target | Target Info | [35] | ||
Proto-oncogene c-Myc (MYC) | Literature-reported Target | Target Info | [30] | ||
RAC-beta serine/threonine-protein kinase (AKT2) | Literature-reported Target | Target Info | [1] | ||
Rhodopsin (RHO) | Literature-reported Target | Target Info | [36] | ||
S-methyl-5'-thioadenosine phosphorylase (MTAP) | Literature-reported Target | Target Info | [37] | ||
Dual specificity protein phosphatase 10 (DUSP10) | Literature-reported Target | Target Info | [38] | ||
Lysine N-methyltransferase 3A (SETD2) | Literature-reported Target | Target Info | [39] | ||
Maspin (SERPINB5) | Literature-reported Target | Target Info | [40] | ||
Mitotic growth and transcription activator (BAF190A) | Literature-reported Target | Target Info | [41] | ||
Protein-tyrosine phosphatase pez (PTPN14) | Literature-reported Target | Target Info | [1] | ||
Rotamase F (PPIF) | Literature-reported Target | Target Info | [11] | ||
Ubiquitin thioesterase OTU1 (YOD1) | Literature-reported Target | Target Info | [11] | ||
Zinc finger protein A20 (TNFAIP3) | Literature-reported Target | Target Info | [9] | ||
Apoptosis antigen ligand (CD178) | Literature-reported Target | Target Info | [42] | ||
CCAAT/enhancer binding protein beta (CEBPB) | Literature-reported Target | Target Info | [14] | ||
Forkhead box protein O1A (FOXO1) | Literature-reported Target | Target Info | [43] | ||
High mobility group protein B1 (HMGB1) | Literature-reported Target | Target Info | [14] | ||
Polycomb complex protein BMI-1 (BMI1) | Literature-reported Target | Target Info | [44] | ||
DNA mismatch repair protein MSH2 (MSH2) | Literature-reported Target | Target Info | [11] | ||
GTPase activating protein (RASA1) | Literature-reported Target | Target Info | [45] | ||
Melanoma differentiation-associated protein 6 (CDKN1A) | Literature-reported Target | Target Info | [31] | ||
T-lymphoma invasion and metastasis 1 (TIAM1) | Literature-reported Target | Target Info | [46] | ||
Transcription factor E2F2 (E2F2) | Literature-reported Target | Target Info | [30] | ||
Transcription factor SOX-2 (SOX2) | Literature-reported Target | Target Info | [11] | ||
Vitiligo-associated protein 1 (FBXO11) | Literature-reported Target | Target Info | [11] | ||
Clusterin (CLU) | Literature-reported Target | Target Info | [47] | ||
Suppressor of cytokine signaling 1 (SOCS1) | Literature-reported Target | Target Info | [48] | ||
Suppressor of tumorigenicity 15 protein (ST15) | Literature-reported Target | Target Info | [11] | ||
Transcription factor SOX-5 (SOX5) | Literature-reported Target | Target Info | [37] | ||
Protein(s) Regulated by This miRNA | 15-hydroxyprostaglandin dehydrogenase [NAD(+)] | Regulated Protein | [49] | ||
26S proteasome non-ATPase regulatory subunit 9 | Regulated Protein | [50] | |||
40S ribosomal protein S7 | Regulated Protein | [21] | |||
Acidic leucine-rich nuclear phosphoprotein 32 family member A | Regulated Protein | [41] | |||
Ankyrin repeat domain-containing protein 46 | Regulated Protein | [53] | |||
Antigen peptide transporter 1 | Regulated Protein | [14] | |||
Apoptosis-stimulating of p53 protein 2 | Regulated Protein | [55] | |||
Apoptotic protease-activating factor 1 | Regulated Protein | [55] | |||
B-cell lymphoma 6 protein | Regulated Protein | [56] | |||
B-cell lymphoma/leukemia 10 | Regulated Protein | [14] | |||
Brain acid soluble protein 1 | Regulated Protein | [21] | |||
Cell adhesion molecule 1 | Regulated Protein | [57] | |||
Collagen alpha-1(IV) chain | Regulated Protein | [58] | |||
Condensin complex subunit 3 | Regulated Protein | [21] | |||
Cyclin-dependent kinase 2-associated protein 1 | Regulated Protein | [59] | |||
Death domain-associated protein 6 | Regulated Protein | [55] | |||
Dedicator of cytokinesis protein 4 | Regulated Protein | [60] | |||
Dedicator of cytokinesis protein 5 | Regulated Protein | [60] | |||
Dedicator of cytokinesis protein 7 | Regulated Protein | [60] | |||
Derlin-1 | Regulated Protein | [21] | |||
DNA mismatch repair protein Msh6 | Regulated Protein | [61] | |||
DNA-binding protein SATB1 | Regulated Protein | [62] | |||
Dual specificity mitogen-activated protein kinase kinase 3 | Regulated Protein | [63] | |||
Dynamin-1-like protein | Regulated Protein | [64] | |||
E3 SUMO-protein ligase CBX4 | Regulated Protein | [14] | |||
E3 SUMO-protein ligase PIAS3 | Regulated Protein | [65] | |||
E3 ubiquitin-protein ligase CHIP | Regulated Protein | [66] | |||
E3 ubiquitin-protein ligase pellino homolog 1 | Regulated Protein | [10] | |||
E3 ubiquitin-protein ligase rififylin | Regulated Protein | [10] | |||
E3 ubiquitin-protein ligase Topors | Regulated Protein | [55] | |||
E3 ubiquitin-protein ligase TRAF7 | Regulated Protein | [25] | |||
E3 ubiquitin-protein transferase RMND5A | Regulated Protein | [10] | |||
ELAV-like protein 4 | Regulated Protein | [69] | |||
Eukaryotic initiation factor 4A-II | Regulated Protein | [53] | |||
Eukaryotic translation initiation factor 2 subunit 1 | Regulated Protein | [21] | |||
Extracellular superoxide dismutase [Cu-Zn] | Regulated Protein | [70] | |||
Fibromodulin | Regulated Protein | [71] | |||
Forkhead box protein P3 | Regulated Protein | [72] | |||
Frizzled-6 | Regulated Protein | [73] | |||
Heterogeneous nuclear ribonucleoprotein K | Regulated Protein | [55] | |||
Homeobox protein TGIF1 | Regulated Protein | [71] | |||
Homeodomain-interacting protein kinase 3 | Regulated Protein | [10] | |||
Iron-sulfur cluster assembly enzyme ISCU, mitochondrial | Regulated Protein | [74] | |||
Junction-mediating and -regulatory protein | Regulated Protein | [55] | |||
Leucine-rich repeat flightless-interacting protein 1 | Regulated Protein | [75] | |||
Metalloproteinase inhibitor 3 | Regulated Protein | [11] | |||
Multifunctional procollagen lysine hydroxylase and glycosyltransferase LH3 | Regulated Protein | [21] | |||
Myocyte-specific enhancer factor 2C | Regulated Protein | [77] | |||
N(G),N(G)-dimethylarginine dimethylaminohydrolase 1 | Regulated Protein | [78] | |||
Neuron navigator 3 | Regulated Protein | [79] | |||
Neuroserpin | Regulated Protein | [80] | |||
Nuclear factor 1 A-type | Regulated Protein | [81] | |||
Nuclear factor 1 B-type | Regulated Protein | [82] | |||
Partner of Y14 and mago | Regulated Protein | [21] | |||
Pentraxin-related protein PTX3 | Regulated Protein | [9] | |||
Phosphatidylinositol 3-kinase regulatory subunit alpha | Regulated Protein | [84] | |||
Poly(rC)-binding protein 1 | Regulated Protein | [21] | |||
Polycomb group RING finger protein 2 | Regulated Protein | [85] | |||
Programmed cell death protein 4 | Regulated Protein | [86] | |||
Prostaglandin G/H synthase 2 | Regulated Protein | [87] | |||
Protein BTG2 | Regulated Protein | [88] | |||
Protein CASC2, isoforms 1/2 | Regulated Protein | [89] | |||
Protein jagged-1 | Regulated Protein | [90] | |||
Protein sprouty homolog 2 | Regulated Protein | [91] | |||
Pyruvate dehydrogenase E1 component subunit alpha, testis-specific form, mitochondrial | Regulated Protein | [21] | |||
RAS guanyl-releasing protein 1 | Regulated Protein | [92] | |||
RE1-silencing transcription factor | Regulated Protein | [93] | |||
Rho-related GTP-binding protein RhoB | Regulated Protein | [94] | |||
SAM and SH3 domain-containing protein 1 | Regulated Protein | [10] | |||
Selenocysteine insertion sequence-binding protein 2-like | Regulated Protein | [10] | |||
SPATS2-like protein | Regulated Protein | [21] | |||
Suppressor of cytokine signaling 6 | Regulated Protein | [48] | |||
TIR domain-containing adapter molecule 2 | Regulated Protein | [14] | |||
Torsin-1A-interacting protein 2 | Regulated Protein | [10] | |||
Transcription factor 21 | Regulated Protein | [96] | |||
Transforming growth factor beta receptor type 3 | Regulated Protein | [55] | |||
Transforming growth factor-beta-induced protein ig-h3 | Regulated Protein | [97] | |||
Transmembrane 9 superfamily member 3 | Regulated Protein | [21] | |||
Tropomyosin alpha-1 chain | Regulated Protein | [98] | |||
Tumor protein 63 | Regulated Protein | [55] | |||
Ubiquitin-conjugating enzyme E2 N | Regulated Protein | [14] | |||
Wolframin | Regulated Protein | [21] | |||
References | |||||
REF 1 | Downregulation of miR-21 inhibits EGFR pathway and suppresses the growth of human glioblastoma cells independent of PTEN status. Lab Invest. 2010 Feb;90(2):144-55. | ||||
REF 2 | Up-regulation of miR-21 by HER2/neu signaling promotes cell invasion. J Biol Chem. 2009 Jul 3;284(27):18515-24. | ||||
REF 3 | MicroRNA-21 modulates biological functions of pancreatic cancer cells including their proliferation, invasion, and chemoresistance. Mol Cancer Ther. 2009 May;8(5):1067-74. | ||||
REF 4 | Physiological identification of human transcripts translationally regulated by a specific microRNA. Hum Mol Genet. 2005 Dec 15;14(24):3813-21. | ||||
REF 5 | Modulation of microRNAs in hypertension-induced arterial remodeling through the 1 and 3-adrenoreceptor pathways. J Mol Cell Cardiol. 2013 Dec;65:127-36. | ||||
REF 6 | Antagonism of miRNA-21 Sensitizes Human Gastric Cancer Cells to Paclitaxel. Cell Biochem Biophys. 2015 May;72(1):275-82. | ||||
REF 7 | Michael T. McManus: Interrupting biology [interview by Hema Bashyam]. J Exp Med. 2008 Mar 17;205(3):506-7. | ||||
REF 8 | miR-21-mediated tumor growth. Oncogene. 2007 Apr 26;26(19):2799-803. | ||||
REF 9 | Induction of miR-21 by retinoic acid in estrogen receptor-positive breast carcinoma cells: biological correlates and molecular targets. J Biol Chem. 2011 Feb 4;286(5):4027-42. | ||||
REF 10 | MicroRNA profiling in mucosal biopsies of eosinophilic esophagitis patients pre and post treatment with steroids and relationship with mRNA targets. PLoS One. 2012;7(7):e40676. | ||||
REF 11 | MicroRNA 21 promotes glioma invasion by targeting matrix metalloproteinase regulators. Mol Cell Biol. 2008 Sep;28(17):5369-80. | ||||
REF 12 | Hypomethylation of miR-142 promoter and upregulation of microRNAs that target the oxytocin receptor gene in the autism prefrontal cortex. Mol Autism. 2015 Aug 14;6:46. | ||||
REF 13 | MicroRNA-21 controls the development of osteoarthritis by targeting GDF-5 in chondrocytes. Exp Mol Med. 2014 Feb 28;46:e79. | ||||
REF 14 | Regulation of NF-B signaling by oxidized glycerophospholipid and IL-1 induced miRs-21-3p and -27a-5p in human aortic endothelial cells. J Lipid Res. 2015 Jan;56(1):38-50. | ||||
REF 15 | Regulation of the extrinsic apoptotic pathway by microRNA-21 in alcoholic liver injury. J Biol Chem. 2014 Oct 3;289(40):27526-39. | ||||
REF 16 | Pseudorabies viral replication is inhibited by a novel target of miR-21. Virology. 2014 May;456-457:319-28. | ||||
REF 17 | A microRNA expression signature of human solid tumors defines cancer gene targets. Proc Natl Acad Sci U S A. 2006 Feb 14;103(7):2257-61. | ||||
REF 18 | Identification of MiR-21-5p as a Functional Regulator of Mesothelin Expression Using MicroRNA Capture Affinity Coupled with Next Generation Sequencing. PLoS One. 2017 Jan 26;12(1):e0170999. | ||||
REF 19 | c-Myc-regulated microRNAs modulate E2F1 expression. Nature. 2005 Jun 9;435(7043):839-43. | ||||
REF 20 | MiR-21 is involved in cervical squamous cell tumorigenesis and regulates CCL20. Biochim Biophys Acta. 2012 Feb;1822(2):248-60. | ||||
REF 21 | Identification of miR-21 targets in breast cancer cells using a quantitative proteomic approach. Proteomics. 2009 Mar;9(5):1374-84. | ||||
REF 22 | MicroRNA-21 in scleroderma fibrosis and its function in TGF--regulated fibrosis-related genes expression. J Clin Immunol. 2013 Aug;33(6):1100-9. | ||||
REF 23 | MicroRNA-21 directly targets MARCKS and promotes apoptosis resistance and invasion in prostate cancer cells. Biochem Biophys Res Commun. 2009 Jun 5;383(3):280-5. | ||||
REF 24 | MicroRNA-21 represses human cystathionine gamma-lyase expression by targeting at specificity protein-1 in smooth muscle cells. J Cell Physiol. 2012 Sep;227(9):3192-200. | ||||
REF 25 | A set of NF-B-regulated microRNAs induces acquired TRAIL resistance in lung cancer. Proc Natl Acad Sci U S A. 2015 Jun 30;112(26):E3355-64. | ||||
REF 26 | HCV-induced miR-21 contributes to evasion of host immune system by targeting MyD88 and IRAK1. PLoS Pathog. 2013;9(4):e1003248. | ||||
REF 27 | Blockage of a miR-21/EGFR regulatory feedback loop augments anti-EGFR therapy in glioblastomas. Cancer Lett. 2014 Jan 1;342(1):139-49. | ||||
REF 28 | Neurotrophin-3 mRNA a putative target of miR21 following status epilepticus. Brain Res. 2011 Nov 18;1424:53-9. | ||||
REF 29 | The let-7 microRNA represses cell proliferation pathways in human cells. Cancer Res. 2007 Aug 15;67(16):7713-22. | ||||
REF 30 | Estradiol-regulated microRNAs control estradiol response in breast cancer cells. Nucleic Acids Res. 2009 Aug;37(14):4850-61. | ||||
REF 31 | Programmed cell death 4 (PDCD4) is an important functional target of the microRNA miR-21 in breast cancer cells. J Biol Chem. 2008 Jan 11;283(2):1026-33. | ||||
REF 32 | miR-21 contributes to renal protection by targeting prolyl hydroxylase domain protein 2 in delayed ischaemic preconditioning. Nephrology (Carlton). 2017 May;22(5):366-373. | ||||
REF 33 | Mutation of miR-21 targets endogenous lipoprotein receptor-related protein 6 and nonalcoholic fatty liver disease. Am J Transl Res. 2017 Feb 15;9(2):715-721. | ||||
REF 34 | Sirt2 suppresses glioma cell growth through targeting NF-B-miR-21 axis. Biochem Biophys Res Commun. 2013 Nov 22;441(3):661-7. | ||||
REF 35 | Prediction of mammalian microRNA targets. Cell. 2003 Dec 26;115(7):787-98. | ||||
REF 36 | Targeting miR-21 inhibits in vitro and in vivo multiple myeloma cell growth. Clin Cancer Res. 2013 Apr 15;19(8):2096-106. | ||||
REF 37 | MicroRNA-21 down-regulates the expression of tumor suppressor PDCD4 in human glioblastoma cell T98G. Cancer Lett. 2008 Dec 18;272(2):197-205. | ||||
REF 38 | Downregulation of inflammatory microRNAs by Ig-like transcript 3 is essential for the differentiation of human CD8(+) T suppressor cells. J Immunol. 2012 Apr 1;188(7):3042-52. | ||||
REF 39 | A feedback regulatory loop between HIF-1 and miR-21 in response to hypoxia in cardiomyocytes. FEBS Lett. 2014 Aug 25;588(17):3137-46. | ||||
REF 40 | MicroRNA-21 targets tumor suppressor genes in invasion and metastasis. Cell Res. 2008 Mar;18(3):350-9. | ||||
REF 41 | MicroRNA-21 targets tumor suppressor genes ANP32A and SMARCA4. Oncogene. 2011 Jun 30;30(26):2975-85. | ||||
REF 42 | Foxo3a regulates apoptosis by negatively targeting miR-21. J Biol Chem. 2010 May 28;285(22):16958-66. | ||||
REF 43 | MicroRNA-21 plays an oncogenic role by targeting FOXO1 and activating the PI3K/AKT pathway in diffuse large B-cell lymphoma. Oncotarget. 2015 Jun 20;6(17):15035-49. | ||||
REF 44 | Bmi-1 regulates stem cell-like properties of gastric cancer cells via modulating miRNAs. J Hematol Oncol. 2016 Sep 20;9(1):90. | ||||
REF 45 | MiR-21/RASA1 axis affects malignancy of colon cancer cells via RAS pathways. World J Gastroenterol. 2015 Feb 7;21(5):1488-97. | ||||
REF 46 | miR-21 and miR-31 converge on TIAM1 to regulate migration and invasion of colon carcinoma cells. J Biol Chem. 2010 Nov 12;285(46):35293-302. | ||||
REF 47 | Clusterin is a gene-specific target of microRNA-21 in head and neck squamous cell carcinoma. Clin Cancer Res. 2014 Feb 15;20(4):868-77. | ||||
REF 48 | MiR-21 and MiR-155 promote non-small cell lung cancer progression by downregulating SOCS1, SOCS6, and PTEN. Oncotarget. 2016 Dec 20;7(51):84508-84519. | ||||
REF 49 | miR-21 targets 15-PGDH and promotes cholangiocarcinoma growth.Mol Cancer Res. 2014 Jun;12(6):890-900. | ||||
REF 50 | Celastrol induces cell cycle arrest by MicroRNA-21-mTOR-mediated inhibition p27 protein degradation in gastric cancer.Cancer Cell Int. 2015 Oct 24;15:101. | ||||
REF 51 | Identification of miR-21 targets in breast cancer cells using a quantitative proteomic approach. Proteomics. 2009 Mar;9(5):1374-84. | ||||
REF 52 | MicroRNA-21 targets tumor suppressor genes ANP32A and SMARCA4. Oncogene. 2011 Jun 30;30(26):2975-85. | ||||
REF 53 | Knockdown of miR-21 in human breast cancer cell lines inhibits proliferation, in vitro migration and in vivo tumor growth.Breast Cancer Res. 2011 Jan 10;13(1):R2. | ||||
REF 54 | Regulation of NF-B signaling by oxidized glycerophospholipid and IL-1 induced miRs-21-3p and -27a-5p in human aortic endothelial cells. J Lipid Res. 2015 Jan;56(1):38-50. | ||||
REF 55 | MicroRNA-21 targets a network of key tumor-suppressive pathways in glioblastoma cells. Cancer Res. 2008 Oct 1;68(19):8164-72. | ||||
REF 56 | The Bcl6 target gene microRNA-21 promotes Th2 differentiation by a T cell intrinsic pathway.Mol Immunol. 2013 Jul;54(3-4):435-42. | ||||
REF 57 | MYCN-mediated miR-21 overexpression enhances chemo-resistance via targeting CADM1 in tongue cancer.J Mol Med (Berl). 2016 Oct;94(10):1129-1141. | ||||
REF 58 | MiR-21 is enriched in the RNA-induced silencing complex and targets COL4A1 in human granulosa cell lines.Reprod Sci. 2012 Oct;19(10):1030-40. | ||||
REF 59 | miR-21 downregulates the tumor suppressor P12 CDK2AP1 and stimulates cell proliferation and invasion.J Cell Biochem. 2011 Mar;112(3):872-80. | ||||
REF 60 | Bone morphogenetic protein 4 promotes vascular smooth muscle contractility by activating microRNA-21 (miR-21), which down-regulates expression of family of dedicator of cytokinesis (DOCK) proteins.J Biol Chem. 2012 Feb 3;287(6):3976-86. | ||||
REF 61 | MicroRNA-21 induces resistance to 5-fluorouracil by down-regulating human DNA MutS homolog 2 (hMSH2). Proc Natl Acad Sci U S A. 2010 Dec 7;107(49):21098-103. | ||||
REF 62 | miR-21 regulates chronic hypoxia-induced pulmonary vascular remodeling. Am J Physiol Lung Cell Mol Physiol. 2012 Mar 15;302(6):L521-9. | ||||
REF 63 | MicroRNA-21 promotes hepatocellular carcinoma HepG2 cell proliferation through repression of mitogen-activated protein kinase-kinase 3.BMC Cancer. 2013 Oct 10;13:469. | ||||
REF 64 | miR-21-5p/203a-3p promote ox-LDL-induced endothelial cell senescence through down-regulation of mitochondrial fission protein Drp1.Mech Ageing Dev. 2017 Jun;164:8-19. | ||||
REF 65 | Identification of novel miR-21 target proteins in multiple myeloma cells by quantitative proteomics.J Proteome Res. 2012 Apr 6;11(4):2078-90. | ||||
REF 66 | Human Stem Cells Overexpressing miR-21 Promote Angiogenesis in Critical Limb Ischemia by Targeting CHIP to Enhance HIF-1 Activity.Stem Cells. 2016 Apr;34(4):924-34. | ||||
REF 67 | MicroRNA profiling in mucosal biopsies of eosinophilic esophagitis patients pre and post treatment with steroids and relationship with mRNA targets. PLoS One. 2012;7(7):e40676. | ||||
REF 68 | A set of NF-B-regulated microRNAs induces acquired TRAIL resistance in lung cancer. Proc Natl Acad Sci U S A. 2015 Jun 30;112(26):E3355-64. | ||||
REF 69 | miR-375 inhibits differentiation of neurites by lowering HuD levels.Mol Cell Biol. 2010 Sep;30(17):4197-210. | ||||
REF 70 | MicroRNA-21 modulates the levels of reactive oxygen species by targeting SOD3 and TNF.Cancer Res. 2012 Sep 15;72(18):4707-13. | ||||
REF 71 | microRNA 21: response to hormonal therapies and regulatory function in leiomyoma, transformed leiomyoma and leiomyosarcoma cells. Mol Hum Reprod. 2010 Mar;16(3):215-27. | ||||
REF 72 | MicroRNA-21 negatively regulates Treg cells through a TGF-1/Smad-independent pathway in patients with coronary heart disease. Cell Physiol Biochem. 2015;37(3):866-78. | ||||
REF 73 | FZD6, targeted by miR-21, represses gastric cancer cell proliferation and migration via activating non-canonical wnt pathway. Am J Transl Res. 2016 May 15;8(5):2354-64. | ||||
REF 74 | MicroRNA-21 is involved in osteosarcoma cell invasion and migration. Med Oncol. 2011 Dec;28(4):1469-74. | ||||
REF 75 | MicroRNA-21 targets LRRFIP1 and contributes to VM-26 resistance in glioblastoma multiforme.Brain Res. 2009 Aug 25;1286:13-8. | ||||
REF 76 | MicroRNA 21 promotes glioma invasion by targeting matrix metalloproteinase regulators. Mol Cell Biol. 2008 Sep;28(17):5369-80. | ||||
REF 77 | MicroRNA-21 dysregulates the expression of MEF2C in neurons in monkey and human SIV/HIV neurological disease.Cell Death Dis. 2010;1:e77. | ||||
REF 78 | MicroRNA21 promotes interstitial fibrosis via targeting DDAH1: a potential role in renal fibrosis.Mol Cell Biochem. 2016 Jan;411(1-2):181-9. | ||||
REF 79 | The passenger strand, miR-21-3p, plays a role in mediating cisplatin resistance in ovarian cancer cells.Gynecol Oncol. 2015 Apr;137(1):143-51. | ||||
REF 80 | MicroRNA-21 inhibits Serpini1, a gene with novel tumour suppressive effects in gastric cancer.Dig Liver Dis. 2012 Jul;44(7):589-96. | ||||
REF 81 | MicroRNA 21 (miR-21) and miR-181b couple with NFI-A to generate myeloid-derived suppressor cells and promote immunosuppression in late sepsis.Infect Immun. 2014 Sep;82(9):3816-25. | ||||
REF 82 | miR-21 Gene expression triggered by AP-1 is sustained through a double-negative feedback mechanism.J Mol Biol. 2008 May 2;378(3):492-504. | ||||
REF 83 | Induction of miR-21 by retinoic acid in estrogen receptor-positive breast carcinoma cells: biological correlates and molecular targets. J Biol Chem. 2011 Feb 4;286(5):4027-42. | ||||
REF 84 | PIK3R1 targeting by miR-21 suppresses tumor cell migration and invasion by reducing PI3K/AKT signaling and reversing EMT, and predicts clinical outcome of breast cancer.Int J Oncol. 2016 Feb;48(2):471-84. | ||||
REF 85 | Mel-18 negatively regulates stem cell-like properties through downregulation of miR-21 in gastric cancer.Oncotarget. 2016 Sep 27;7(39):63352-63361. | ||||
REF 86 | MicroRNA-21 (miR-21) post-transcriptionally downregulates tumor suppressor Pdcd4 and stimulates invasion, intravasation and metastasis in colorectal cancer.Oncogene. 2008 Apr 3;27(15):2128-36. | ||||
REF 87 | miR-21 inhibits the effects of cyclooxygenase-2 inhibitor NS398 on apoptosis and invasion in gastric cancer cells.Onco Targets Ther. 2015 Nov 4;8:3245-53. | ||||
REF 88 | Regulation of the cell cycle gene, BTG2, by miR-21 in human laryngeal carcinoma.Cell Res. 2009 Jul;19(7):828-37. | ||||
REF 89 | Long non-coding RNA CASC2 suppresses malignancy in human gliomas by miR-21.Cell Signal. 2015 Feb;27(2):275-82. | ||||
REF 90 | MicroRNA profiling identifies miR-34a and miR-21 and their target genes JAG1 and WNT1 in the coordinate regulation of dendritic cell differentiation.Blood. 2009 Jul 9;114(2):404-14. | ||||
REF 91 | MicroRNA-21 targets Sprouty2 and promotes cellular outgrowths.Mol Biol Cell. 2008 Aug;19(8):3272-82. | ||||
REF 92 | MicroRNA-21 and microRNA-148a contribute to DNA hypomethylation in lupus CD4+ T cells by directly and indirectly targeting DNA methyltransferase 1. J Immunol. 2010 Jun 15;184(12):6773-81. | ||||
REF 93 | Is REST a regulator of pluripotency Nature. 2009 Feb 26;457(7233):E5-6; discussion E7. | ||||
REF 94 | Overexpression of miR-21 promotes an in vitro metastatic phenotype by targeting the tumor suppressor RHOB.Mol Cancer Res. 2010 May;8(5):691-700. | ||||
REF 95 | MiR-21 and MiR-155 promote non-small cell lung cancer progression by downregulating SOCS1, SOCS6, and PTEN. Oncotarget. 2016 Dec 20;7(51):84508-84519. | ||||
REF 96 | miR-21 downregulated TCF21 to inhibit KISS1 in renal cancer.Urology. 2012 Dec;80(6):1298-302.e1. | ||||
REF 97 | A single anti-microRNA antisense oligodeoxyribonucleotide (AMO) targeting multiple microRNAs offers an improved approach for microRNA interference.Nucleic Acids Res. 2009 Feb;37(3):e24. | ||||
REF 98 | MicroRNA-21 targets the tumor suppressor gene tropomyosin 1 (TPM1).J Biol Chem. 2007 May 11;282(19):14328-36. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.