Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T86264 |
Target Info
|
| Target Name |
Solute carrier family 40 member 1 (SLC40A1) |
| Synonyms |
SLC11A3; MSTP079; IREG1; Ferroportin-1; FPN1 |
| Target Type |
Clinical trial Target |
| Gene Name |
SLC40A1 |
| Biochemical Class |
Ferroportin protein |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-485-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
gucauacacggcucuccucucu
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
Enforced miR-485 expression led to significant inhibition of FPN 3'UTR reporter activity. |
[1] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Luciferase Reporter Assay; qRT-PCR; Western Blot |
[1] |
| Representative Target(s) Regulated by This miRNA |
NT-3 growth factor receptor (TrkC)
|
Target Info
|
|
|
Polybromo-1 (PBRM1)
|
Target Info
|
|
| References |
Top |
| REF 1 |
Iron-responsive miR-485-3p regulates cellular iron homeostasis by targeting ferroportin. PLoS Genet. 2013 Apr;9(4):e1003408.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
