Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T88975 |
Target Info
|
| Target Name |
Phosphodiesterase 3A (PDE3A) |
| Synonyms |
cGMP-inhibited 3',5'-cyclic phosphodiesterase A; Phosphodiesterase 3A; Cyclic GMP-inhibited phosphodiesterase A; Cyclic GMP inhibited phosphodiesterase A; CGI-PDE A |
| Target Type |
Successful Target |
| Gene Name |
PDE3A |
| Biochemical Class |
Phosphoric diester hydrolase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-211-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uucccuuugucauccuucgccu
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
PDE3A is generally down-regulated by miR-211 indirectly drives the expression of miR-211. |
[1] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Reporter Assay |
[1] |
| 2 |
Luciferase Reporter Assay; Western Blot |
[1] |
| Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
|
Calcium-activated potassium channel KCa1.1 (KCNMA1)
|
Target Info
|
|
| References |
Top |
| REF 1 |
New target genes of MITF-induced microRNA-211 contribute to melanoma cell invasion. PLoS One. 2013 Sep 5;8(9):e73473.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
