miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-211-5p | ||||
| miRNA Stemloop AC | MI0000287 | ||||
| miRNA Stemloop ID | hsa-mir-211 | ||||
| Sequence | uucccuuugucauccuucgccu | ||||
| TTD Target(s) Regulated by This miRNA | Cyclin-dependent kinase 6 (CDK6) | Successful Target | Target Info | [1] | |
| Phosphodiesterase 3A (PDE3A) | Successful Target | Target Info | [2] | ||
| Ribonucleoside-diphosphate reductase M2 (RRM2) | Successful Target | Target Info | [3] | ||
| Apoptosis regulator Bcl-2 (BCL-2) | Successful Target | Target Info | [4] | ||
| Transforming growth factor beta 1 (TGFB1) | Successful Target | Target Info | [5] | ||
| Mannose-6-phosphate receptor (M6PR) | Successful Target | Target Info | [2] | ||
| ERK activator kinase 1 (MEK1) | Clinical trial Target | Target Info | [4] | ||
| Matrix metalloproteinase-9 (MMP-9) | Clinical trial Target | Target Info | [6] | ||
| G1/S-specific cyclin-D1 (CCND1) | Clinical trial Target | Target Info | [1] | ||
| Interleukin-11 (IL11) | Clinical trial Target | Target Info | [7] | ||
| TGF-beta receptor type II (TGFBR2) | Clinical trial Target | Target Info | [2] | ||
| CI Man-6-P receptor (IGF2R) | Clinical trial Target | Target Info | [2] | ||
| Facilitates chromatin transcription complex (FACT) | Clinical trial Target | Target Info | [2] | ||
| Calcium-activated potassium channel KCa1.1 (KCNMA1) | Clinical trial Target | Target Info | [8] | ||
| Omphalocele kinase 1 (NUAK1) | Literature-reported Target | Target Info | [9] | ||
| Vitamin D3 up-regulated protein 1 (VDUP1) | Literature-reported Target | Target Info | [10] | ||
| IP3 receptor isoform 1 (ITPR1) | Literature-reported Target | Target Info | [4] | ||
| Osteonectin (SPARC) | Literature-reported Target | Target Info | [11] | ||
| Ras-related protein Rab-22A (Rab22a) | Literature-reported Target | Target Info | [12] | ||
| Vascular endothelial cadherin (CDH5) | Literature-reported Target | Target Info | [13] | ||
| Protein(s) Regulated by This miRNA | AP-1 complex subunit sigma-2 | Regulated Protein | [2] | ||
| Cyclic AMP-responsive element-binding protein 5 | Regulated Protein | [12] | |||
| DNA damage-inducible transcript 3 protein | Regulated Protein | [2] | |||
| DNA-binding protein SATB2 | Regulated Protein | [16] | |||
| Elongation of very long chain fatty acids protein 6 | Regulated Protein | [12] | |||
| Homeobox protein HMX1 | Regulated Protein | [17] | |||
| Interferon-induced GTP-binding protein Mx1 | Regulated Protein | [10] | |||
| Interleukin-10 receptor subunit alpha | Regulated Protein | [19] | |||
| Mucin-4 | Regulated Protein | [20] | |||
| Nuclear factor of activated T-cells 5 | Regulated Protein | [2] | |||
| POU domain, class 3, transcription factor 2 | Regulated Protein | [21] | |||
| Serine incorporator 3 | Regulated Protein | [2] | |||
| Transcription factor 12 | Regulated Protein | [12] | |||
| Transcription factor SOX-4 | Regulated Protein | [22] | |||
| Zinc finger protein SNAI1 | Regulated Protein | [23] | |||
| References | |||||
| REF 1 | miR-211 suppresses epithelial ovarian cancer proliferation and cell-cycle progression by targeting Cyclin D1 and CDK6. Mol Cancer. 2015 Mar 11;14:57. | ||||
| REF 2 | New target genes of MITF-induced microRNA-211 contribute to melanoma cell invasion. PLoS One. 2013 Sep 5;8(9):e73473. | ||||
| REF 3 | miR-211 modulates gemcitabine activity through downregulation of ribonucleotide reductase and inhibits the invasive behavior of pancreatic cancer cells. Nucleosides Nucleotides Nucleic Acids. 2014;33(4-6):384-93. | ||||
| REF 4 | The changes of miRNA expression in rat hippocampus following chronic lead exposure. Toxicol Lett. 2014 Aug 17;229(1):158-66. | ||||
| REF 5 | miR-211 promotes the progression of head and neck carcinomas by targeting TGFRII. Cancer Lett. 2013 Aug 28;337(1):115-24. | ||||
| REF 6 | Epigenetic regulation of miRNA-211 by MMP-9 governs glioma cell apoptosis, chemosensitivity and radiosensitivity. Oncotarget. 2012 Nov;3(11):1439-54. | ||||
| REF 7 | Identification of microRNAs inhibiting TGF--induced IL-11 production in bone metastatic breast cancer cells. PLoS One. 2012;7(5):e37361. | ||||
| REF 8 | The regulation of miRNA-211 expression and its role in melanoma cell invasiveness. PLoS One. 2010 Nov 1;5(11):e13779. | ||||
| REF 9 | Transcription factor/microRNA axis blocks melanoma invasion program by miR-211 targeting NUAK1. J Invest Dermatol. 2014 Feb;134(2):441-451. | ||||
| REF 10 | Genome-wide identification of target genes for miR-204 and miR-211 identifies their proliferation stimulatory role in breast cancer cells. Sci Rep. 2016 Apr 28;6:25287. | ||||
| REF 11 | MiRNA-211 suppresses cell proliferation, migration and invasion by targeting SPARC in human hepatocellular carcinoma. Sci Rep. 2016 May 27;6:26679. | ||||
| REF 12 | Microphthalmia-associated transcription factor (MITF) promotes differentiation of human retinal pigment epithelium (RPE) by regulating microRNAs-204/211 expression. J Biol Chem. 2012 Jun 8;287(24):20491-503. | ||||
| REF 13 | MicroRNA-211 expression promotes colorectal cancer cell growth in vitro and in vivo by targeting tumor suppressor CHD5. PLoS One. 2012;7(1):e29750. | ||||
| REF 14 | New target genes of MITF-induced microRNA-211 contribute to melanoma cell invasion. PLoS One. 2013 Sep 5;8(9):e73473. | ||||
| REF 15 | Microphthalmia-associated transcription factor (MITF) promotes differentiation of human retinal pigment epithelium (RPE) by regulating microRNAs-204/211 expression. J Biol Chem. 2012 Jun 8;287(24):20491-503. | ||||
| REF 16 | miR-211 suppresses hepatocellular carcinoma by downregulating SATB2.Oncotarget. 2015 Apr 20;6(11):9457-66. | ||||
| REF 17 | MiR-204/miR-211 downregulation contributes to candidemia-induced kidney injuries via derepression of Hmx1 expression.Life Sci. 2014 May 2;102(2):139-44. | ||||
| REF 18 | Genome-wide identification of target genes for miR-204 and miR-211 identifies their proliferation stimulatory role in breast cancer cells. Sci Rep. 2016 Apr 28;6:25287. | ||||
| REF 19 | IL-10R expression is post-transcriptionally regulated by miR-15a, miR-185, and miR-211 in melanoma.BMC Med Genomics. 2015 Dec 3;8:81. | ||||
| REF 20 | MiR-211 inhibits invasion and epithelial-to-mesenchymal transition (EMT) of cervical cancer cells via targeting MUC4.Biochem Biophys Res Commun. 2017 Apr 1;485(2):556-562. | ||||
| REF 21 | Melanoma cell invasiveness is regulated by miR-211 suppression of the BRN2 transcription factor.Pigment Cell Melanoma Res. 2011 Jun;24(3):525-37. | ||||
| REF 22 | MiR-211 inhibits cell proliferation and invasion of gastric cancer by down-regulating SOX4. Int J Clin Exp Pathol. 2015 Nov 1;8(11):14013-20. | ||||
| REF 23 | miR-211-5p Suppresses Metastatic Behavior by Targeting SNAI1 in Renal Cancer.Mol Cancer Res. 2017 Apr;15(4):448-456. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.