Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T89859 |
Target Info
|
| Target Name |
Orphan nuclear receptor SHP (NR0B2) |
| Synonyms |
Small heterodimer partner; Short heterodimer partner; SHP; Nuclear receptor subfamily 0 group B member 2 |
| Target Type |
Literature-reported Target |
| Gene Name |
NR0B2 |
| Biochemical Class |
Nuclear hormone receptor |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-141-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uaacacugucugguaaagaugg
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Immunohistochemistry; PCR |
[1] |
| 2 |
Luciferase Reporter Assay |
[2] |
| Representative Target(s) Regulated by This miRNA |
Activin receptor type IIB (ACVR2B)
|
Target Info
|
|
|
Bromodomain-containing protein 3 (BRD3)
|
Target Info
|
|
| References |
Top |
| REF 1 |
Aberrant expression of miR-141 and nuclear receptor small heterodimer partner in clinical samples of prostate cancer. Cancer Biomark. 2018;22(1):19-28.
|
| REF 2 |
miR-141 modulates androgen receptor transcriptional activity in human prostate cancer cells through targeting the small heterodimer partner protein. Prostate. 2012 Oct 1;72(14):1514-22.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
