miRNA General Information
miRNA Mature ID	hsa-miR-141-3p
miRNA Stemloop AC	MI0000457
miRNA Stemloop ID	hsa-mir-141
Sequence	uaacacugucugguaaagaugg
TTD Target(s) Regulated by This miRNA	Insulin-like growth factor I receptor (IGF1R)	Successful Target	Target Info	[1]
	Peroxisome proliferator-activated receptor alpha (PPARA)	Successful Target	Target Info	[2]
	Stress-activated protein kinase 2a (p38 alpha)	Clinical trial Target	Target Info	[3]
	Transforming growth factor beta 2 (TGFB2)	Clinical trial Target	Target Info	[4]
	Bromodomain-containing protein 3 (BRD3)	Clinical trial Target	Target Info	[5]
	Stress-activated protein kinase JNK2 (JNK2)	Preclinical Target	Target Info	[5]
	M-phase inducer phosphatase 1 (MPIP1)	Literature-reported Target	Target Info	[6]
	M-phase inducer phosphatase 3 (MPIP3)	Literature-reported Target	Target Info	[7]
	Activin receptor type IIB (ACVR2B)	Literature-reported Target	Target Info	[8]
	MEK kinase kinase 4 (MAP4K4)	Patented-recorded Target	Target Info	[9]
	Phosphatase and tensin homolog (PTEN)	Literature-reported Target	Target Info	[5]
	Homeodomain interacting protein kinase 2 (HIPK2)	Literature-reported Target	Target Info	[10]
	Orphan nuclear receptor SHP (NR0B2)	Literature-reported Target	Target Info	[11]
	S100 calcium-binding protein A6 (S100A6)	Literature-reported Target	Target Info	[12]
	Eukaryotic initiation factor 4E (EIF4E)	Literature-reported Target	Target Info	[13]
	Hepatoma-derived growth factor (HDGF)	Literature-reported Target	Target Info	[14]
	T-lymphoma invasion and metastasis 1 (TIAM1)	Literature-reported Target	Target Info	[15]
	Yes-associated protein 1 (YAP1)	Literature-reported Target	Target Info	[16]
	Zinc finger E-box-binding homeobox 2 (ZEB2)	Literature-reported Target	Target Info	[17]
Protein(s) Regulated by This miRNA	14-3-3 protein gamma	Regulated Protein	1433G_HUMAN	[18]
	C-terminal-binding protein 2	Regulated Protein	CTBP2_HUMAN	[19]
	CAAX prenyl protease 1 homolog	Regulated Protein	FACE1_HUMAN	[20]
	Chromodomain Y-like protein	Regulated Protein	CDYL_HUMAN	[19]
	Circadian locomoter output cycles protein kaput	Regulated Protein	CLOCK_HUMAN	[21]
	Circadian locomoter output cycles protein kaput	Regulated Protein	CLOCK_HUMAN	[22]
	ELAV-like protein 4	Regulated Protein	ELAV4_HUMAN	[23]
	Engulfment and cell motility protein 2	Regulated Protein	ELMO2_HUMAN	[24]
	Erbin	Regulated Protein	ERBIN_HUMAN	[24]
	Heterogeneous nuclear ribonucleoprotein D0	Regulated Protein	HNRPD_HUMAN	[25]
	Homeobox protein DLX-5	Regulated Protein	DLX5_HUMAN	[26]
	Homeobox protein Hox-B5	Regulated Protein	HXB5_HUMAN	[24]
	Kelch-like protein 20	Regulated Protein	KLH20_HUMAN	[24]
	Krueppel-like factor 11	Regulated Protein	KLF11_HUMAN	[24]
	Krueppel-like factor 12	Regulated Protein	KLF12_HUMAN	[27]
	Krueppel-like factor 5	Regulated Protein	KLF5_HUMAN	[21]
	Methylcytosine dioxygenase TET1	Regulated Protein	TET1_HUMAN	[28]
	Methylcytosine dioxygenase TET3	Regulated Protein	TET3_HUMAN	[28]
	Pappalysin-1	Regulated Protein	PAPP1_HUMAN	[29]
	PH domain leucine-rich repeat-containing protein phosphatase 1	Regulated Protein	PHLP1_HUMAN	[30]
	PH domain leucine-rich repeat-containing protein phosphatase 2	Regulated Protein	PHLP2_HUMAN	[30]
	Protein VAC14 homolog	Regulated Protein	VAC14_HUMAN	[24]
	Ras and Rab interactor 2	Regulated Protein	RIN2_HUMAN	[24]
	Ras association domain-containing protein 2	Regulated Protein	RASF2_HUMAN	[24]
	Receptor-type tyrosine-protein phosphatase delta	Regulated Protein	PTPRD_HUMAN	[24]
	Retinoblastoma-associated protein	Regulated Protein	RB_HUMAN	[12]
	Septin-7	Regulated Protein	SEPT7_HUMAN	[24]
	Serine/threonine-protein kinase 3	Regulated Protein	STK3_HUMAN	[21]
	SHC-transforming protein 1	Regulated Protein	SHC1_HUMAN	[24]
	Signal transducer and activator of transcription 4	Regulated Protein	STAT4_HUMAN	[32]
	Splicing factor, proline- and glutamine-rich	Regulated Protein	SFPQ_HUMAN	[33]
	Tafazzin	Regulated Protein	TAZ_HUMAN	[34]
	Trafficking protein particle complex subunit 2B	Regulated Protein	TPC2B_HUMAN	[35]
	Transcription factor 7-like 1	Regulated Protein	TF7L1_HUMAN	[24]
	Transcription factor Dp-2	Regulated Protein	TFDP2_HUMAN	[5]
	Transmembrane 4 L6 family member 1	Regulated Protein	T4S1_HUMAN	[37]
	Ubiquitin carboxyl-terminal hydrolase BAP1	Regulated Protein	BAP1_HUMAN	[24]
	Ubiquitin-associated protein 1	Regulated Protein	UBAP1_HUMAN	[5]
	WD repeat-containing protein 37	Regulated Protein	WDR37_HUMAN	[24]
	Zinc finger E-box-binding homeobox 1	Regulated Protein	ZEB1_HUMAN	[17]
	Zinc finger protein ZFPM2	Regulated Protein	FOG2_HUMAN	[24]
References
REF 1	Anti-proliferative role and prognostic implication of miR-141 in gastric cancer. Am J Transl Res. 2016 Aug 15;8(8):3549-57.
REF 2	MicroRNA-141 represses HBV replication by targeting PPARA. PLoS One. 2012;7(3):e34165.
REF 3	miR-141 and miR-200a act on ovarian tumorigenesis by controlling oxidative stress response. Nat Med. 2011 Nov 20;17(12):1627-35.
REF 4	A reciprocal repression between ZEB1 and members of the miR-200 family promotes EMT and invasion in cancer cells. EMBO Rep. 2008 Jun;9(6):582-9.
REF 5	microRNA-141 is involved in a nasopharyngeal carcinoma-related genes network. Carcinogenesis. 2010 Apr;31(4):559-66.
REF 6	miR-141-3p inhibits human stromal (mesenchymal) stem cell proliferation and differentiation. Biochim Biophys Acta. 2014 Sep;1843(9):2114-21.
REF 7	MicroRNA-141 is downregulated in human renal cell carcinoma and regulates cell survival by targeting CDC25B. Onco Targets Ther. 2013 Apr 10;6:349-54.
REF 8	miR-192, miR-194, miR-215, miR-200c and miR-141 are downregulated and their common target ACVR2B is strongly expressed in renal childhood neoplasms. Carcinogenesis. 2012 May;33(5):1014-21.
REF 9	miRNA-141, downregulated in pancreatic cancer, inhibits cell proliferation and invasion by directly targeting MAP4K4. Mol Cancer Ther. 2013 Nov;12(11):2569-80.
REF 10	miR-141 regulates TGF-1-induced epithelial-mesenchymal transition through repression of HIPK2 expression in renal tubular epithelial cells. Int J Mol Med. 2015 Feb;35(2):311-8.
REF 11	miR-141 modulates androgen receptor transcriptional activity in human prostate cancer cells through targeting the small heterodimer partner protein. Prostate. 2012 Oct 1;72(14):1514-22.
REF 12	Progesterone downregulation of miR-141 contributes to expansion of stem-like breast cancer cells through maintenance of progesterone receptor and Stat5a. Oncogene. 2015 Jul;34(28):3676-87.
REF 13	Enterovirus-induced miR-141 contributes to shutoff of host protein translation by targeting the translation initiation factor eIF4E. Cell Host Microbe. 2011 Jan 20;9(1):58-69.
REF 14	miR-141 suppresses proliferation and motility of gastric cancer cells by targeting HDGF. Mol Cell Biochem. 2014 Mar;388(1-2):211-8.
REF 15	MiR-141 suppresses the migration and invasion of HCC cells by targeting Tiam1. PLoS One. 2014 Feb 13;9(2):e88393.
REF 16	Elucidation of transcriptome-wide microRNA binding sites in human cardiac tissues by Ago2 HITS-CLIP. Nucleic Acids Res. 2016 Sep 6;44(15):7120-31.
REF 17	The miR-200 family inhibits epithelial-mesenchymal transition and cancer cell migration by direct targeting of E-cadherin transcriptional repressors ZEB1 and ZEB2. J Biol Chem. 2008 May 30;283(22):14910-4.
REF 18	miRNA and protein expression profiles of visceral adipose tissue reveal miR-141/YWHAG and miR-520e/RAB11A as two potential miRNA/protein target pairs associated with severe obesity.J Proteome Res. 2012 Jun 1;11(6):3358-69.
REF 19	MicroRNAs coordinately regulate protein complexes.BMC Syst Biol. 2011 Aug 25;5:136.
REF 20	MicroRNA-141-3p plays a role in human mesenchymal stem cell aging by directly targeting ZMPSTE24.J Cell Sci. 2013 Dec 1;126(Pt 23):5422-31.
REF 21	A combined computational-experimental approach predicts human microRNA targets. Genes Dev. 2004 May 15;18(10):1165-78.
REF 22	Involvement of human micro-RNA in growth and response to chemotherapy in human cholangiocarcinoma cell lines. Gastroenterology. 2006 Jun;130(7):2113-29.
REF 23	miR-375 inhibits differentiation of neurites by lowering HuD levels.Mol Cell Biol. 2010 Sep;30(17):4197-210.
REF 24	Conserved MicroRNA miR-8/miR-200 and its target USH/FOG2 control growth by regulating PI3K.Cell. 2009 Dec 11;139(6):1096-108.
REF 25	MicroRNA-141 and microRNA-146b-5p inhibit the prometastatic mesenchymal characteristics through the RNA-binding protein AUF1 targeting the transcription factor ZEB1 and the protein kinase AKT.J Biol Chem. 2014 Nov 7;289(45):31433-47.
REF 26	MicroRNA-141 and -200a are involved in bone morphogenetic protein-2-induced mouse pre-osteoblast differentiation by targeting distal-less homeobox 5.J Biol Chem. 2009 Jul 17;284(29):19272-9.
REF 27	MicroRNA-141 enhances anoikis resistance in metastatic progression of ovarian cancer through targeting KLF12/Sp1/survivin axis.Mol Cancer. 2017 Jan 17;16(1):11.
REF 28	Regulation of miR-200c and miR-141 by Methylation in Prostate Cancer. Prostate. 2016 Sep;76(13):1146-59.
REF 29	MicroRNA-141 inhibits vascular smooth muscle cell proliferation through targeting PAPP-A. Int J Clin Exp Pathol. 2015 Nov 1;8(11):14401-8.
REF 30	MicroRNA-141 promotes the proliferation of non-small cell lung cancer cells by regulating expression of PHLPP1 and PHLPP2.FEBS Lett. 2014 Aug 25;588(17):3055-61.
REF 31	Progesterone downregulation of miR-141 contributes to expansion of stem-like breast cancer cells through maintenance of progesterone receptor and Stat5a. Oncogene. 2015 Jul;34(28):3676-87.
REF 32	Down-regulation of miR-141 induced by helicobacter pylori promotes the invasion of gastric cancer by targeting STAT4.Cell Physiol Biochem. 2014;33(4):1003-12.
REF 33	Identification of human microRNA targets from isolated argonaute protein complexes.RNA Biol. 2007 Jun;4(2):76-84.
REF 34	MicroRNA-141 inhibits tumor growth and metastasis in gastric cancer by directly targeting transcriptional co-activator with PDZ-binding motif, TAZ.Cell Death Dis. 2015 Jan 29;6:e1623.
REF 35	MicroRNAs are differentially expressed in ulcerative colitis and alter expression of macrophage inflammatory peptide-2 alpha.Gastroenterology. 2008 Nov;135(5):1624-1635.e24.
REF 36	microRNA-141 is involved in a nasopharyngeal carcinoma-related genes network. Carcinogenesis. 2010 Apr;31(4):559-66.
REF 37	hsa-miR-141 downregulates TM4SF1 to inhibit pancreatic cancer cell invasion and migration.Int J Oncol. 2014 Feb;44(2):459-66.
REF 38	The miR-200 family inhibits epithelial-mesenchymal transition and cancer cell migration by direct targeting of E-cadherin transcriptional repressors ZEB1 and ZEB2. J Biol Chem. 2008 May 30;283(22):14910-4.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.