Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T96876 |
Target Info
|
| Target Name |
Collagen VII (COL7A1) |
| Synonyms |
Longchain collagen; Long-chain collagen; LC collagen; Collagen alpha1(VII) chain; Collagen alpha-1(VII) chain |
| Target Type |
Clinical trial Target |
| Gene Name |
COL7A1 |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-29c-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uagcaccauuugaaaucgguua
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
A significant decrease in luciferase activity in HEK293T miR-29c target constructs containing the 3' UTRs of COL7A1. |
[2] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Report Assay; RT-PCR; Immunoblot |
[1] |
| 2 |
Luciferase Reporter Assay |
[2] |
| Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
|
B7 homolog 3 (CD276)
|
Target Info
|
|
| References |
Top |
| REF 1 |
miR-29 Regulates Type VII Collagen in Recessive Dystrophic Epidermolysis Bullosa. J Invest Dermatol. 2016 Oct;136(10):2013-2021.
|
| REF 2 |
Functional microRNA involved in endometriosis. Mol Endocrinol. 2011 May;25(5):821-32.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
