miRNA Details

miRNA General Information
miRNA Mature ID hsa-miR-29c-3p
miRNA Stemloop AC MI0000735
miRNA Stemloop ID hsa-mir-29c
Sequence uagcaccauuugaaaucgguua
TTD Target(s) Regulated by This miRNA HMG-CoA reductase (HMGCR) Successful Target Target Info [1]
Matrix metalloproteinase-2 (MMP-2) Successful Target Target Info [2]
Cyclin-dependent kinase 6 (CDK6) Successful Target Target Info [3]
Platelet-derived growth factor receptor beta (PDGFRB) Successful Target Target Info [2]
Apoptosis regulator Bcl-2 (BCL-2) Successful Target Target Info [4]
Programmed cell death 1 ligand 1 (PD-L1) Successful Target Target Info [5]
Vascular endothelial growth factor A (VEGFA) Successful Target Target Info [1]
NAD-dependent deacetylase sirtuin-1 (SIRT1) Clinical trial Target Target Info [6]
RAC-gamma serine/threonine-protein kinase (AKT3) Successful Target Target Info [1]
DNA [cytosine-5]-methyltransferase 3B (DNMT3B) Clinical trial Target Target Info [7]
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) Clinical trial Target Target Info [8]
Induced myeloid leukemia cell differentiation protein Mcl-1 (MCL1) Clinical trial Target Target Info [4]
Integrin beta-1 (ITGB1) Clinical trial Target Target Info [9]
Beta-secretase 1 (BACE1) Clinical trial Target Target Info [10]
B7 homolog 3 (CD276) Clinical trial Target Target Info [11]
Collagen I (COL1A2) Clinical trial Target Target Info [8]
Kruppel like factor 4 (KLF4) Clinical trial Target Target Info [12]
Transcription factor Sp1 (SP1) Clinical trial Target Target Info [13]
DNA [cytosine-5]-methyltransferase 3A (DNMT3A) Patented-recorded Target Target Info [7]
LDL receptor related protein-6 (LRP-6) Clinical trial Target Target Info [14]
Phosphatase and tensin homolog (PTEN) Literature-reported Target Target Info [15]
RAC-beta serine/threonine-protein kinase (AKT2) Literature-reported Target Target Info [16]
Fibrinogen (FGG) Literature-reported Target Target Info [17]
Insulin-like growth factor-binding protein 1 (IGFBP1) Literature-reported Target Target Info [18]
Lysyl oxidase (LOX) Literature-reported Target Target Info [2]
Matrix metalloproteinase-15 (MMP-15) Literature-reported Target Target Info [19]
Integrin alpha-6 (ITGA6) Literature-reported Target Target Info [20]
Laminin gamma-2 subunit (LAMC2) Literature-reported Target Target Info [21]
N-myc proto-oncogene protein (MYCN) Literature-reported Target Target Info [22]
Osteonectin (SPARC) Literature-reported Target Target Info [8]
T-lymphoma invasion and metastasis 1 (TIAM1) Literature-reported Target Target Info [23]
Collagen VII (COL7A1) Clinical trial Target Target Info [18]
Protein(s) Regulated by This miRNA Apoptosis-stimulating of p53 protein 1 Regulated Protein
ASPP1_HUMAN
[24]
Beta/gamma crystallin domain-containing protein 1 Regulated Protein
CRBG1_HUMAN
[25]
Catenin delta-1 Regulated Protein
CTND1_HUMAN
[26]
CCR4-NOT transcription complex subunit 6 Regulated Protein
CNOT6_HUMAN
[27]
Cell division control protein 42 homolog Regulated Protein
CDC42_HUMAN
[24]
Collagen alpha-1(I) chain Regulated Protein
CO1A1_HUMAN
[8]
Collagen alpha-1(III) chain Regulated Protein
CO3A1_HUMAN
[8]
Collagen alpha-1(IV) chain Regulated Protein
CO4A1_HUMAN
[8]
Collagen alpha-1(X) chain Regulated Protein
COAA1_HUMAN
[2]
Collagen alpha-1(XV) chain Regulated Protein
COFA1_HUMAN
[8]
Collagen alpha-1(XXI) chain Regulated Protein
COLA1_HUMAN
[18]
Collagen alpha-2(IV) chain Regulated Protein
CO4A2_HUMAN
[8]
Collagen alpha-2(V) chain Regulated Protein
CO5A2_HUMAN
[2]
Collagen alpha-2(VI) chain Regulated Protein
CO6A2_HUMAN
[11]
Cyclic AMP-responsive element-binding protein 5 Regulated Protein
CREB5_HUMAN
[32]
Desmocollin-2 Regulated Protein
DSC2_HUMAN
[25]
Disintegrin and metalloproteinase domain-containing protein 12 Regulated Protein
ADA12_HUMAN
[33]
DNA-binding protein RFX7 Regulated Protein
RFX7_HUMAN
[34]
E3 ubiquitin-protein ligase AMFR Regulated Protein
AMFR_HUMAN
[25]
Epithelial membrane protein 1 Regulated Protein
EMP1_HUMAN
[25]
Fibrillin-1 Regulated Protein
FBN1_HUMAN
[8]
Fibrinogen alpha chain Regulated Protein
FIBA_HUMAN
[17]
Fibrinogen beta chain Regulated Protein
FIBB_HUMAN
[17]
Frizzled-4 Regulated Protein
FZD4_HUMAN
[14]
Frizzled-5 Regulated Protein
FZD5_HUMAN
[14]
G/T mismatch-specific thymine DNA glycosylase Regulated Protein
TDG_HUMAN
[8]
G1/S-specific cyclin-D2 Regulated Protein
CCND2_HUMAN
[37]
GSK-3-binding protein FRAT2 Regulated Protein
FRAT2_HUMAN
[14]
Homeobox protein TGIF2 Regulated Protein
TGIF2_HUMAN
[32]
Laminin subunit gamma-1 Regulated Protein
LAMC1_HUMAN
[8]
Matrix metalloproteinase-24 Regulated Protein
MMP24_HUMAN
[19]
Max dimerization protein 1 Regulated Protein
MAD1_HUMAN
[25]
Methylcytosine dioxygenase TET2 Regulated Protein
TET2_HUMAN
[39]
Nuclear autoantigenic sperm protein Regulated Protein
NASP_HUMAN
[40]
Period circadian protein homolog 1 Regulated Protein
PER1_HUMAN
[41]
Phosphatase and actin regulator 2 Regulated Protein
PHAR2_HUMAN
[25]
Pleckstrin homology-like domain family B member 2 Regulated Protein
PHLB2_HUMAN
[42]
Probable methyltransferase TARBP1 Regulated Protein
TARB1_HUMAN
[34]
Protein RCC2 Regulated Protein
RCC2_HUMAN
[43]
Protein Wnt-4 Regulated Protein
WNT4_HUMAN
[18]
Serine/arginine-rich splicing factor 10 Regulated Protein
SRS10_HUMAN
[8]
Serine/threonine-protein kinase RIO3 Regulated Protein
RIOK3_HUMAN
[25]
Serpin H1 Regulated Protein
SERPH_HUMAN
[2]
Sorting nexin-24 Regulated Protein
SNX24_HUMAN
[25]
Transcription factor AP-2 gamma Regulated Protein
AP2C_HUMAN
[18]
Transmembrane protein 132A Regulated Protein
T132A_HUMAN
[11]
Tubulin beta-2A chain Regulated Protein
TBB2A_HUMAN
[25]
WD repeat-containing protein 26 Regulated Protein
WDR26_HUMAN
[25]
References
REF 1 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
REF 2 A miRNA-regulatory network explains how dysregulated miRNAs perturb oncogenic processes across diverse cancers. Genome Res. 2012 Nov;22(11):2302-14.
REF 3 microRNA expression profile and identification of miR-29 as a prognostic marker and pathogenetic factor by targeting CDK6 in mantle cell lymphoma. Blood. 2010 Apr 1;115(13):2630-9.
REF 4 Effects of microRNA-29 on apoptosis, tumorigenicity, and prognosis of hepatocellular carcinoma. Hepatology. 2010 Mar;51(3):836-45.
REF 5 Identifying microRNAs regulating B7-H3 in breast cancer: the clinical impact of microRNA-29c. Br J Cancer. 2014 Apr 15;110(8):2072-80.
REF 6 MicroRNA-29c functions as a tumor suppressor by direct targeting oncogenic SIRT1 in hepatocellular carcinoma. Oncogene. 2014 May 15;33(20):2557-67.
REF 7 MicroRNA-29 family reverts aberrant methylation in lung cancer by targeting DNA methyltransferases 3A and 3B. Proc Natl Acad Sci U S A. 2007 Oct 2;104(40):15805-10.
REF 8 MicroRNA 29c is down-regulated in nasopharyngeal carcinomas, up-regulating mRNAs encoding extracellular matrix proteins. Proc Natl Acad Sci U S A. 2008 Apr 15;105(15):5874-8.
REF 9 MicroRNA-29c mediates initiation of gastric carcinogenesis by directly targeting ITGB1. Gut. 2015 Feb;64(2):203-14.
REF 10 miR-29c regulates BACE1 protein expression. Brain Res. 2011 Jun 13;1395:108-15.
REF 11 Fibrotic extracellular matrix activates a profibrotic positive feedback loop. J Clin Invest. 2014 Apr;124(4):1622-35.
REF 12 Disruption of miR-29 Leads to Aberrant Differentiation of Smooth Muscle Cells Selectively Associated with Distal Lung Vasculature. PLoS Genet. 2015 May 28;11(5):e1005238.
REF 13 miR-29c contribute to glioma cells temozolomide sensitivity by targeting O6-methylguanine-DNA methyltransferases indirectely. Oncotarget. 2016 Aug 2;7(31):50229-50238.
REF 14 Reduction of miR-29c enhances pancreatic cancer cell migration and stem cell-like phenotype. Oncotarget. 2015 Feb 20;6(5):2767-78.
REF 15 YAP mediates crosstalk between the Hippo and PI(3)KOR pathways by suppressing PTEN via miR-29. Nat Cell Biol. 2012 Dec;14(12):1322-9.
REF 16 MicroRNA-29s could target AKT2 to inhibit gastric cancer cells invasion ability. Med Oncol. 2015 Jan;32(1):342.
REF 17 Regulation of fibrinogen production by microRNAs. Blood. 2010 Oct 7;116(14):2608-15.
REF 18 Functional microRNA involved in endometriosis. Mol Endocrinol. 2011 May;25(5):821-32.
REF 19 MicroRNAs profiling in murine models of acute and chronic asthma: a relationship with mRNAs targets. PLoS One. 2011 Jan 28;6(1):e16509.
REF 20 Tumour-suppressive microRNA-29s inhibit cancer cell migration and invasion by targeting laminin-integrin signalling in head and neck squamous cell carcinoma. Br J Cancer. 2013 Nov 12;109(10):2636-45.
REF 21 A combined computational-experimental approach predicts human microRNA targets. Genes Dev. 2004 May 15;18(10):1165-78.
REF 22 Tumour-suppressor microRNAs let-7 and mir-101 target the proto-oncogene MYCN and inhibit cell proliferation in MYCN-amplified neuroblastoma. Br J Cancer. 2011 Jul 12;105(2):296-303.
REF 23 MiR-29c suppresses invasion and metastasis by targeting TIAM1 in nasopharyngeal carcinoma. Cancer Lett. 2013 Feb 28;329(2):181-8.
REF 24 miR-29 miRNAs activate p53 by targeting p85 alpha and CDC42.Nat Struct Mol Biol. 2009 Jan;16(1):23-9.
REF 25 MicroRNA profiling in mucosal biopsies of eosinophilic esophagitis patients pre and post treatment with steroids and relationship with mRNA targets. PLoS One. 2012;7(7):e40676.
REF 26 Chemotherapy-Induced miRNA-29c/Catenin- Signaling Suppresses Metastasis in Gastric Cancer.Cancer Res. 2015 Apr 1;75(7):1332-44.
REF 27 miR-148a-3p overexpression contributes to glomerular cell proliferation by targeting PTEN in lupus nephritis.Am J Physiol Cell Physiol. 2016 Mar 15;310(6):C470-8.
REF 28 MicroRNA 29c is down-regulated in nasopharyngeal carcinomas, up-regulating mRNAs encoding extracellular matrix proteins. Proc Natl Acad Sci U S A. 2008 Apr 15;105(15):5874-8.
REF 29 A miRNA-regulatory network explains how dysregulated miRNAs perturb oncogenic processes across diverse cancers. Genome Res. 2012 Nov;22(11):2302-14.
REF 30 Functional microRNA involved in endometriosis. Mol Endocrinol. 2011 May;25(5):821-32.
REF 31 Fibrotic extracellular matrix activates a profibrotic positive feedback loop. J Clin Invest. 2014 Apr;124(4):1622-35.
REF 32 Regulation of miRNA-29c and its downstream pathways in preneoplastic progression of triple-negative breast cancer. Oncotarget. 2017 Mar 21;8(12):19645-19660.
REF 33 ADAM12-L is a direct target of the miR-29 and miR-200 families in breast cancer.BMC Cancer. 2015 Mar 4;15:93.
REF 34 H9N2 avian influenza virus enhances the immune responses of BMDCs by down-regulating miR29c.Vaccine. 2017 Feb 1;35(5):729-737.
REF 35 Regulation of fibrinogen production by microRNAs. Blood. 2010 Oct 7;116(14):2608-15.
REF 36 Reduction of miR-29c enhances pancreatic cancer cell migration and stem cell-like phenotype. Oncotarget. 2015 Feb 20;6(5):2767-78.
REF 37 Characterization of microRNA-29 family expression and investigation of their mechanistic roles in gastric cancer. Carcinogenesis. 2014 Feb;35(2):497-506.
REF 38 MicroRNAs profiling in murine models of acute and chronic asthma: a relationship with mRNAs targets. PLoS One. 2011 Jan 28;6(1):e16509.
REF 39 An extensive network of TET2-targeting MicroRNAs regulates malignant hematopoiesis.Cell Rep. 2013 Oct 31;5(2):471-81.
REF 40 microRNA-29c inhibits cell proliferation by targeting NASP in human gastric cancer.BMC Cancer. 2017 Feb 7;17(1):109.
REF 41 MiR-29a/b/c regulate human circadian gene hPER1 expression by targeting its 3'UTR.Acta Biochim Biophys Sin (Shanghai). 2014 Apr;46(4):313-7.
REF 42 p53 target miR-29c-3p suppresses colon cancer cell invasion and migration through inhibition of PHLDB2.Biochem Biophys Res Commun. 2017 May 20;487(1):90-95.
REF 43 MiR-29c is downregulated in gastric carcinomas and regulates cell proliferation by targeting RCC2.Mol Cancer. 2013 Feb 25;12:15.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.