miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-let-7i-5p | ||||
| miRNA Stemloop AC | MI0000434 | ||||
| miRNA Stemloop ID | hsa-let-7i | ||||
| Sequence | ugagguaguaguuugugcuguu | ||||
| TTD Target(s) Regulated by This miRNA | Interleukin-2 (IL2) | Successful Target | Target Info | [1] | |
| Aurora kinase B (AURKB) | Clinical trial Target | Target Info | [2] | ||
| Interleukin-13 (IL13) | Successful Target | Target Info | [3] | ||
| Toll-like receptor 4 (TLR4) | Clinical trial Target | Target Info | [4] | ||
| Insulin-like growth factor-I (IGF1) | Clinical trial Target | Target Info | [5] | ||
| Bone morphogenetic protein 4 (BMP4) | Literature-reported Target | Target Info | [6] | ||
| Suppressor of cytokine signaling 1 (SOCS1) | Literature-reported Target | Target Info | [7] | ||
| Protein(s) Regulated by This miRNA | Achaete-scute homolog 1 | Regulated Protein | [8] | ||
| COP9 signalosome complex subunit 1 | Regulated Protein | [9] | |||
| COP9 signalosome complex subunit 6 | Regulated Protein | [9] | |||
| COP9 signalosome complex subunit 8 | Regulated Protein | [9] | |||
| Neurogenin-1 | Regulated Protein | [8] | |||
| Protein argonaute-1 | Regulated Protein | [10] | |||
| References | |||||
| REF 1 | MicroRNA target site identification by integrating sequence and binding information. Nat Methods. 2013 Jul;10(7):630-3. | ||||
| REF 2 | Let-7i inhibits the malignant phenotype of osteosarcoma cells by targeting Aurora-B. Mol Med Rep. 2015 Sep;12(3):3543-3548. | ||||
| REF 3 | Let-7 microRNA-mediated regulation of IL-13 and allergic airway inflammation. J Allergy Clin Immunol. 2011 Nov;128(5):1077-85.e1-10. | ||||
| REF 4 | A cellular micro-RNA, let-7i, regulates Toll-like receptor 4 expression and contributes to cholangiocyte immune responses against Cryptosporidium parvum infection. J Biol Chem. 2007 Sep 28;282(39):28929-38. | ||||
| REF 5 | MicroRNA let-7i induced autophagy to protect T cell from apoptosis by targeting IGF1R. Biochem Biophys Res Commun. 2014 Oct 31;453(4):728-34. | ||||
| REF 6 | Repression of bone morphogenetic protein 4 by let-7i attenuates mesenchymal migration of head and neck cancer cells. Biochem Biophys Res Commun. 2013 Mar 29;433(1):24-30. | ||||
| REF 7 | Inhibition of microRNA let-7i depresses maturation and functional state of dendritic cells in response to lipopolysaccharide stimulation via targeting suppressor of cytokine signaling 1. J Immunol. 2011 Aug 15;187(4):1674-83. | ||||
| REF 8 | SOX2-LIN28/let-7 pathway regulates proliferation and neurogenesis in neural precursors.Proc Natl Acad Sci U S A. 2013 Aug 6;110(32):E3017-26. | ||||
| REF 9 | Post-transcriptional fine-tuning of COP9 signalosome subunit biosynthesis is regulated by the c-Myc/Lin28B/let-7 pathway.J Mol Biol. 2011 Jun 24;409(5):710-21. | ||||
| REF 10 | Hypoxia-responsive miRNAs target argonaute 1 to promote angiogenesis.J Clin Invest. 2013 Mar;123(3):1057-67. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.