miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-106a-5p | ||||
| miRNA Stemloop AC | MI0000113 | ||||
| miRNA Stemloop ID | hsa-mir-106a | ||||
| Sequence | aaaagugcuuacagugcagguag | ||||
| TTD Target(s) Regulated by This miRNA | Aromatase (CYP19A1) | Successful Target | Target Info | [1] | |
| Amyloid beta A4 protein (APP) | Successful Target | Target Info | [2] | ||
| Interleukin-1 beta (IL1B) | Successful Target | Target Info | [3] | ||
| Interleukin-6 (IL6) | Successful Target | Target Info | [3] | ||
| Interleukin-8 (IL8) | Successful Target | Target Info | [3] | ||
| Signal transducer and activator of transcription 3 (STAT3) | Successful Target | Target Info | [4] | ||
| Retinoic acid receptor beta (RARB) | Successful Target | Target Info | [5] | ||
| Transforming growth factor beta 1 (TGFB1) | Successful Target | Target Info | [3] | ||
| Vascular endothelial growth factor A (VEGFA) | Successful Target | Target Info | [6] | ||
| Stress-activated protein kinase 2a (p38 alpha) | Clinical trial Target | Target Info | [7] | ||
| ATM serine/threonine kinase (ATM) | Clinical trial Target | Target Info | [8] | ||
| Cellular tumor antigen p53 (TP53) | Clinical trial Target | Target Info | [9] | ||
| Apoptosis mediating surface antigen FAS (FAS) | Clinical trial Target | Target Info | [10] | ||
| G1/S-specific cyclin-D1 (CCND1) | Clinical trial Target | Target Info | [11] | ||
| Interleukin-10 (IL10) | Clinical trial Target | Target Info | [12] | ||
| TGF-beta receptor type II (TGFBR2) | Clinical trial Target | Target Info | [11] | ||
| Bone morphogenetic protein 2 (BMP2) | Clinical trial Target | Target Info | [13] | ||
| Caspase-7 (CASP7) | Clinical trial Target | Target Info | [14] | ||
| Hypoxia-inducible factor 1 alpha (HIF-1A) | Clinical trial Target | Target Info | [15] | ||
| E2F transcription factor 1 (E2F1) | Clinical trial Target | Target Info | [16] | ||
| Stress-activated protein kinase JNK2 (JNK2) | Preclinical Target | Target Info | [17] | ||
| Phosphatase and tensin homolog (PTEN) | Literature-reported Target | Target Info | [18] | ||
| LIM domain kinase-1 (LIMK-1) | Literature-reported Target | Target Info | [17] | ||
| Serine/threonine-protein kinase ULK1 (ULK1) | Literature-reported Target | Target Info | [19] | ||
| Autophagy-related protein 7 (ATG7) | Literature-reported Target | Target Info | [20] | ||
| Melanoma differentiation-associated protein 6 (CDKN1A) | Literature-reported Target | Target Info | [21] | ||
| Runt-related transcription factor 3 (RUNX3) | Literature-reported Target | Target Info | [11] | ||
| High mobility group protein HMGI-C (HMGA2) | Literature-reported Target | Target Info | [22] | ||
| Protein(s) Regulated by This miRNA | Adenomatous polyposis coli protein | Regulated Protein | [23] | ||
| AT-rich interactive domain-containing protein 4B | Regulated Protein | [24] | |||
| B-cell lymphoma/leukemia 10 | Regulated Protein | [14] | |||
| DNA excision repair protein ERCC-1 | Regulated Protein | [3] | |||
| DNA mismatch repair protein Msh3 | Regulated Protein | [3] | |||
| E3 ubiquitin-protein ligase MYLIP | Regulated Protein | [24] | |||
| Fas-activated serine/threonine kinase | Regulated Protein | [27] | |||
| Homeobox protein CDX-2 | Regulated Protein | [3] | |||
| Homeodomain-interacting protein kinase 3 | Regulated Protein | [24] | |||
| Metalloproteinase inhibitor 2 | Regulated Protein | [28] | |||
| Microsomal glutathione S-transferase 2 | Regulated Protein | [3] | |||
| Mitofusin-2 | Regulated Protein | [29] | |||
| Retinoblastoma-associated protein | Regulated Protein | [18] | |||
| Retinoblastoma-like protein 2 | Regulated Protein | [31] | |||
| Rho-related GTP-binding protein RhoE | Regulated Protein | [3] | |||
| Runt-related transcription factor 1 | Regulated Protein | [32] | |||
| Solute carrier family 2, facilitated glucose transporter member 3 | Regulated Protein | [33] | |||
| TBC1 domain family member 9 | Regulated Protein | [3] | |||
| Tyrosine-protein phosphatase non-receptor type substrate 1 | Regulated Protein | [34] | |||
| References | |||||
| REF 1 | The c-Myc-regulated microRNA-17~92 (miR-17~92) and miR-106a~363 clusters target hCYP19A1 and hGCM1 to inhibit human trophoblast differentiation. Mol Cell Biol. 2013 May;33(9):1782-96. | ||||
| REF 2 | MicroRNAs can regulate human APP levels. Mol Neurodegener. 2008 Aug 6;3:10. | ||||
| REF 3 | The Effects and Molecular Mechanisms of MiR-106a in Multidrug Resistance Reversal in Human Glioma U87/DDP and U251/G Cell Lines. PLoS One. 2015 May 7;10(5):e0125473. | ||||
| REF 4 | Regulation of STAT3 by miR-106a is linked to cognitive impairment in ovariectomized mice. Brain Res. 2013 Mar 29;1503:43-52. | ||||
| REF 5 | miRNA-106a directly targeting RARB associates with the expression of Na(+)/I(-) symporter in thyroid cancer by regulating MAPK signaling pathway. J Exp Clin Cancer Res. 2016 Jun 24;35(1):101. | ||||
| REF 6 | The effect of central loops in miRNA:MRE duplexes on the efficiency of miRNA-mediated gene regulation. PLoS One. 2008 Mar 5;3(3):e1719. | ||||
| REF 7 | The miR-17/106-p38 axis is a key regulator of the neurogenic-to-gliogenic transition in developing neural stem/progenitor cells. Proc Natl Acad Sci U S A. 2014 Jan 28;111(4):1604-9. | ||||
| REF 8 | Estrogen receptor regulates ATM Expression through miRNAs in breast cancer. Clin Cancer Res. 2013 Sep 15;19(18):4994-5002. | ||||
| REF 9 | Upregulation of the miR-17-92 cluster and its two paraloga in osteosarcoma - reasons and consequences. Genes Cancer. 2014 Apr;5(1-2):56-63. | ||||
| REF 10 | MicroRNA-106a functions as an oncogene in human gastric cancer and contributes to proliferation and metastasis in vitro and in vivo. Clin Exp Metastasis. 2016 Jun;33(5):509-19. | ||||
| REF 11 | Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41. | ||||
| REF 12 | Posttranscriptional regulation of interleukin-10 expression by hsa-miR-106a. Proc Natl Acad Sci U S A. 2009 Apr 7;106(14):5761-6. | ||||
| REF 13 | miR-17-5p and miR-106a are involved in the balance between osteogenic and adipogenic differentiation of adipose-derived mesenchymal stem cells. Stem Cell Res. 2013 May;10(3):313-24. | ||||
| REF 14 | Dysregulation of miR-106a and miR-591 confers paclitaxel resistance to ovarian cancer. Br J Cancer. 2013 Jul 23;109(2):452-61. | ||||
| REF 15 | EMMPRIN Down-regulating miR-106a/b Modifies Breast Cancer Stem-like Cell Properties via Interaction with Fibroblasts Through STAT3 and HIF-1. Sci Rep. 2016 Jun 21;6:28329. | ||||
| REF 16 | Deregulated expression of miR-106a predicts survival in human colon cancer patients. Genes Chromosomes Cancer. 2008 Sep;47(9):794-802. | ||||
| REF 17 | The miR-17 family links p63 protein to MAPK signaling to promote the onset of human keratinocyte differentiation. PLoS One. 2012;7(9):e45761. | ||||
| REF 18 | Differential expression of microRNA species in human gastric cancer versus non-tumorous tissues. J Gastroenterol Hepatol. 2009 Apr;24(4):652-7. | ||||
| REF 19 | A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64. | ||||
| REF 20 | miR-106a suppresses tumor cells death in colorectal cancer through targeting ATG7. Med Mol Morphol. 2017 Jun;50(2):76-85. | ||||
| REF 21 | Programmed cell death 4 (PDCD4) is an important functional target of the microRNA miR-21 in breast cancer cells. J Biol Chem. 2008 Jan 11;283(2):1026-33. | ||||
| REF 22 | miR-106a-5p Suppresses the Proliferation, Migration, and Invasion of Osteosarcoma Cells by Targeting HMGA2. DNA Cell Biol. 2016 Sep;35(9):506-20. | ||||
| REF 23 | MicroRNA-106a-5p facilitates human glioblastoma cell proliferation and invasion by targeting adenomatosis polyposis coli protein.Biochem Biophys Res Commun. 2016 Dec 9;481(3-4):245-250. | ||||
| REF 24 | Oncogenic potential of the miR-106-363 cluster and its implication in human T-cell leukemia.Cancer Res. 2007 Jun 15;67(12):5699-707. | ||||
| REF 25 | Dysregulation of miR-106a and miR-591 confers paclitaxel resistance to ovarian cancer. Br J Cancer. 2013 Jul 23;109(2):452-61. | ||||
| REF 26 | The Effects and Molecular Mechanisms of MiR-106a in Multidrug Resistance Reversal in Human Glioma U87/DDP and U251/G Cell Lines. PLoS One. 2015 May 7;10(5):e0125473. | ||||
| REF 27 | miR-106a-5p inhibits the proliferation and migration of astrocytoma cells and promotes apoptosis by targeting FASTK.PLoS One. 2013 Aug 27;8(8):e72390. | ||||
| REF 28 | MicroRNA-106a targets TIMP2 to regulate invasion and metastasis of gastric cancer.FEBS Lett. 2014 Feb 14;588(4):600-7. | ||||
| REF 29 | miR-106a promotes cardiac hypertrophy by targeting mitofusin 2.J Mol Cell Cardiol. 2016 Oct;99:207-217. | ||||
| REF 30 | Differential expression of microRNA species in human gastric cancer versus non-tumorous tissues. J Gastroenterol Hepatol. 2009 Apr;24(4):652-7. | ||||
| REF 31 | miR-106a represses the Rb tumor suppressor p130 to regulate cellular proliferation and differentiation in high-grade serous ovarian carcinoma.Mol Cancer Res. 2013 Nov;11(11):1314-25. | ||||
| REF 32 | MicroRNAs 17-5p-20a-106a control monocytopoiesis through AML1 targeting and M-CSF receptor upregulation.Nat Cell Biol. 2007 Jul;9(7):775-87. | ||||
| REF 33 | Decreased miR-106a inhibits glioma cell glucose uptake and proliferation by targeting SLC2A3 in GBM.BMC Cancer. 2013 Oct 14;13:478. | ||||
| REF 34 | MicroRNA-17/20a/106a modulate macrophage inflammatory responses through targeting signal-regulatory protein .J Allergy Clin Immunol. 2013 Aug;132(2):426-36.e8. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.