miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-144-5p | ||||
| miRNA Stemloop AC | MI0000460 | ||||
| miRNA Stemloop ID | hsa-mir-144 | ||||
| Sequence | ggauaucaucauauacuguaag | ||||
| TTD Target(s) Regulated by This miRNA | Proto-oncogene c-Met (MET) | Successful Target | Target Info | [1] | |
| Rho-associated protein kinase 1 (ROCK1) | Successful Target | Target Info | [2] | ||
| Rho-associated protein kinase 2 (ROCK2) | Successful Target | Target Info | [2] | ||
| G1/S-specific cyclin-E1 (CCNE1) | Literature-reported Target | Target Info | [3] | ||
| G1/S-specific cyclin-E2 (CCNE2) | Literature-reported Target | Target Info | [3] | ||
| Protein(s) Regulated by This miRNA | Homeobox protein TGIF1 | Regulated Protein | [4] | ||
| Mothers against decapentaplegic homolog 4 | Regulated Protein | [5] | |||
| Runt-related transcription factor 1 | Regulated Protein | [6] | |||
| References | |||||
| REF 1 | Down-regulation of micro-RNA-1 (miR-1) in lung cancer. Suppression of tumorigenic property of lung cancer cells and their sensitization to doxorubicin-induced apoptosis by miR-1. J Biol Chem. 2008 Nov 28;283(48):33394-405. | ||||
| REF 2 | MicroRNA-144 suppresses osteosarcoma growth and metastasis by targeting ROCK1 and ROCK2. Oncotarget. 2015 Apr 30;6(12):10297-308. | ||||
| REF 3 | Tumour-suppressive microRNA-144-5p directly targets CCNE1/2 as potential prognostic markers in bladder cancer. Br J Cancer. 2015 Jul 14;113(2):282-9. | ||||
| REF 4 | MicroRNA-144 dysregulates the transforming growth factor- signaling cascade and contributes to the development of bronchiolitis obliterans syndrome after human lung transplantation.J Heart Lung Transplant. 2015 Sep;34(9):1154-62. | ||||
| REF 5 | MiR-144 suppresses cell proliferation, migration, and invasion in hepatocellular carcinoma by targeting SMAD4.Onco Targets Ther. 2016 Jul 29;9:4705-14. | ||||
| REF 6 | Estrogenic gper signaling regulates mir144 expression in cancer cells and cancer-associated fibroblasts (cafs).Oncotarget. 2015 Jun 30;6(18):16573-87. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.