miRNA Details

miRNA General Information
miRNA Mature ID hsa-miR-148a-3p
miRNA Stemloop AC MI0000253
miRNA Stemloop ID hsa-mir-148a
Sequence ucagugcacuacagaacuuugu
TTD Target(s) Regulated by This miRNA Gastrin/cholecystokinin type B receptor (CCKBR) Successful Target Target Info [1]
Matrix metalloproteinase-7 (MMP-7) Successful Target Target Info [2]
Proto-oncogene c-Met (MET) Successful Target Target Info [3]
Sphingosine-1-phosphate receptor 1 (S1PR1) Successful Target Target Info [4]
Apoptosis regulator Bcl-2 (BCL-2) Successful Target Target Info [5]
Signal transducer and activator of transcription 3 (STAT3) Successful Target Target Info [6]
Neuropilin-1 (NRP1) Successful Target Target Info [7]
Rho-associated protein kinase 1 (ROCK1) Successful Target Target Info [8]
Inhibitor of nuclear factor kappa-B kinase beta (IKKB) Clinical trial Target Target Info [9]
Mixed lineage kinase 1 (MAP3K9) Clinical trial Target Target Info [10]
DNA [cytosine-5]-methyltransferase 1 (DNMT1) Clinical trial Target Target Info [11]
DNA [cytosine-5]-methyltransferase 3B (DNMT3B) Clinical trial Target Target Info [12]
Endothelial plasminogen activator inhibitor (SERPINE1) Clinical trial Target Target Info [13]
Integrin alpha-5 (ITGA5) Clinical trial Target Target Info [13]
M-phase inducer phosphatase 2 (MPIP2) Clinical trial Target Target Info [14]
Transforming growth factor beta 2 (TGFB2) Clinical trial Target Target Info [15]
Activin receptor-like kinase 2 (ALK-2) Clinical trial Target Target Info [16]
Pregnane X receptor (NR1I2) Literature-reported Target Target Info [17]
Proto-oncogene c-Myc (MYC) Literature-reported Target Target Info [18]
Ribosomal protein S6 kinase alpha-5 (RSK5) Patented-recorded Target Target Info [19]
Activated leukocyte cell adhesionmolecule (ALCAM) Clinical trial Target Target Info [20]
Integrin beta-8 (ITGB8) Clinical trial Target Target Info [13]
MAPK/ERK kinase kinase 4 (MAP3K4) Literature-reported Target Target Info [21]
CDK inhibitor 1B p27Kip1 (CDKN1B) Literature-reported Target Target Info [22]
Insulin receptor substrate-1 (IRS1) Clinical trial Target Target Info [23]
Runt-related transcription factor 3 (RUNX3) Literature-reported Target Target Info [24]
Protein(s) Regulated by This miRNA Apoptosis regulator BAX Regulated Protein
BAX_HUMAN
[25]
Bcl-2-like protein 11 Regulated Protein
B2L11_HUMAN
[26]
Chromatin-remodeling ATPase INO80 Regulated Protein
INO80_HUMAN
[27]
ERBB receptor feedback inhibitor 1 Regulated Protein
ERRFI_HUMAN
[26]
Guanine nucleotide exchange factor VAV2 Regulated Protein
VAV2_HUMAN
[13]
HLA class I histocompatibility antigen, alpha chain G Regulated Protein
HLAG_HUMAN
[29]
Homeobox protein TGIF2 Regulated Protein
TGIF2_HUMAN
[30]
Mothers against decapentaplegic homolog 2 Regulated Protein
SMAD2_HUMAN
[31]
Pre-B-cell leukemia transcription factor-interacting protein 1 Regulated Protein
PBIP1_HUMAN
[32]
Protein disulfide-isomerase A3 Regulated Protein
PDIA3_HUMAN
[33]
Protein quaking Regulated Protein
QKI_HUMAN
[34]
Protein Wnt-10b Regulated Protein
WN10B_HUMAN
[35]
Proto-oncogene Wnt-1 Regulated Protein
WNT1_HUMAN
[36]
Transcription factor MafB Regulated Protein
MAFB_HUMAN
[37]
Transmembrane emp24 domain-containing protein 7 Regulated Protein
TMED7_HUMAN
[22]
Ubiquitin carboxyl-terminal hydrolase 4 Regulated Protein
UBP4_HUMAN
[39]
References
REF 1 Altered expression of MiR-148a and MiR-152 in gastrointestinal cancers and its clinical significance. J Gastrointest Surg. 2010 Jul;14(7):1170-9.
REF 2 MicroRNA-148a is downregulated in gastric cancer, targets MMP7, and indicates tumor invasiveness and poor prognosis. Cancer Sci. 2014 Feb;105(2):236-43.
REF 3 MicroRNA-148a suppresses the epithelial-mesenchymal transition and metastasis of hepatoma cells by targeting Met/Snail signaling. Oncogene. 2014 Jul 31;33(31):4069-76.
REF 4 microRNA-148a inhibits hepatocellular carcinoma cell invasion by targeting sphingosine-1-phosphate receptor 1. Exp Ther Med. 2015 Feb;9(2):579-584.
REF 5 MiR-148a promotes apoptosis by targeting Bcl-2 in colorectal cancer. Cell Death Differ. 2011 Nov;18(11):1702-10.
REF 6 MicroRNA-148a suppresses proliferation and invasion potential of non-small cell lung carcinomas via regulation of STAT3. Onco Targets Ther. 2017 Mar 2;10:1353-1361.
REF 7 MiR-148a, a microRNA upregulated in the WNT subgroup tumors, inhibits invasion and tumorigenic potential of medulloblastoma cells by targeting Neur... Oncoscience. 2015 Mar 2;2(4):334-48.
REF 8 MicroRNA-148a suppresses tumor cell invasion and metastasis by downregulating ROCK1 in gastric cancer. Clin Cancer Res. 2011 Dec 15;17(24):7574-83.
REF 9 The stretch responsive microRNA miR-148a-3p is a novel repressor of IKBKB, NF-B signaling, and inflammatory gene expression in human aortic valve cells. FASEB J. 2015 May;29(5):1859-68.
REF 10 In-depth analysis of the interaction of HIV-1 with cellular microRNA biogenesis and effector mechanisms. MBio. 2013 Apr 16;4(2):e000193.
REF 11 MicroRNA-dependent regulation of DNA methyltransferase-1 and tumor suppressor gene expression by interleukin-6 in human malignant cholangiocytes. Hepatology. 2010 Mar;51(3):881-90.
REF 12 MicroRNA-29 family reverts aberrant methylation in lung cancer by targeting DNA methyltransferases 3A and 3B. Proc Natl Acad Sci U S A. 2007 Oct 2;104(40):15805-10.
REF 13 Integrative network analysis reveals active microRNAs and their functions in gastric cancer. BMC Syst Biol. 2011 Jun 26;5:99.
REF 14 MicroRNA-148a is down-regulated in human pancreatic ductal adenocarcinomas and regulates cell survival by targeting CDC25B. Lab Invest. 2011 Oct;91(10):1472-9.
REF 15 miR-148a downregulates the expression of transforming growth factor-2 and SMAD2 in gastric cancer. Int J Oncol. 2016 May;48(5):1877-85.
REF 16 Regulatory MiR-148a-ACVR1/BMP circuit defines a cancer stem cell-like aggressive subtype of hepatocellular carcinoma. Hepatology. 2015 Feb;61(2):574-84.
REF 17 Post-transcriptional regulation of human pregnane X receptor by micro-RNA affects the expression of cytochrome P450 3A4. J Biol Chem. 2008 Apr 11;283(15):9674-80.
REF 18 A c-Myc-MicroRNA functional feedback loop affects hepatocarcinogenesis. Hepatology. 2013 Jun;57(6):2378-89.
REF 19 MiR-148a attenuates paclitaxel resistance of hormone-refractory, drug-resistant prostate cancer PC3 cells by regulating MSK1 expression. J Biol Chem. 2010 Jun 18;285(25):19076-84.
REF 20 MiR-148a and miR-152 reduce tamoxifen resistance in ER+ breast cancer via downregulating ALCAM. Biochem Biophys Res Commun. 2017 Feb 5;483(2):840-846.
REF 21 Role of miR-148a in cutaneous squamous cell carcinoma by repression of MAPK pathway. Arch Biochem Biophys. 2015 Oct 1;583:47-54.
REF 22 miR-148a promoted cell proliferation by targeting p27 in gastric cancer cells. Int J Biol Sci. 2011 May 5;7(5):567-74.
REF 23 A regulatory circuit of miR-148a/152 and DNMT1 in modulating cell transformation and tumor angiogenesis through IGF-IR and IRS1. J Mol Cell Biol. 2013 Feb;5(1):3-13.
REF 24 MicroRNA-148a can regulate runt-related transcription factor 3 gene expression via modulation of DNA methyltransferase 1 in gastric cancer. Mol Cells. 2013 Apr;35(4):313-9.
REF 25 MicroRNA-128a-induced apoptosis in HTR-8/SVneo trophoblast cells contributes to pre-eclampsia.Biomed Pharmacother. 2016 Jul;81:63-70.
REF 26 microRNA-148a is a prognostic oncomiR that targets MIG6 and BIM to regulate EGFR and apoptosis in glioblastoma.Cancer Res. 2014 Mar 1;74(5):1541-53.
REF 27 A combined gene expression and functional study reveals the crosstalk between N-Myc and differentiation-inducing microRNAs in neuroblastoma cells. Oncotarget. 2016 Nov 29;7(48):79372-79387.
REF 28 Integrative network analysis reveals active microRNAs and their functions in gastric cancer. BMC Syst Biol. 2011 Jun 26;5:99.
REF 29 Allele-specific targeting of microRNAs to HLA-G and risk of asthma.Am J Hum Genet. 2007 Oct;81(4):829-34.
REF 30 A microRNA DNA methylation signature for human cancer metastasis. Proc Natl Acad Sci U S A. 2008 Sep 9;105(36):13556-61.
REF 31 microRNA-148a suppresses human gastric cancer cell metastasis by reversing epithelial-to-mesenchymal transition.Tumour Biol. 2013 Dec;34(6):3705-12.
REF 32 Hepatitis B virus X protein represses miRNA-148a to enhance tumorigenesis.J Clin Invest. 2013 Feb;123(2):630-45.
REF 33 MicroRNA-148a inhibits the proliferation and promotes the paclitaxel-induced apoptosis of ovarian cancer cells by targeting PDIA3.Mol Med Rep. 2015 Sep;12(3):3923-3929.
REF 34 NF-B induces miR-148a to sustain TGF-/Smad signaling activation in glioblastoma.Mol Cancer. 2015 Feb 11;14:2.
REF 35 Silencing of miR-148a in cancer-associated fibroblasts results in WNT10B-mediated stimulation of tumor cell motility.Oncogene. 2013 Jul 4;32(27):3246-53.
REF 36 miRNA-148a serves as a prognostic factor and suppresses migration and invasion through Wnt1 in non-small cell lung cancer.PLoS One. 2017 Feb 15;12(2):e0171751.
REF 37 miR-148a regulates osteoclastogenesis by targeting V-maf musculoaponeurotic fibrosarcoma oncogene homolog B.J Bone Miner Res. 2013 May;28(5):1180-90.
REF 38 miR-148a promoted cell proliferation by targeting p27 in gastric cancer cells. Int J Biol Sci. 2011 May 5;7(5):567-74.
REF 39 microRNA-148a dysregulation discriminates poor prognosis of hepatocellular carcinoma in association with USP4 overexpression. Oncotarget. 2014 May 15;5(9):2792-806.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.