miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-148b-3p | ||||
| miRNA Stemloop AC | MI0000811 | ||||
| miRNA Stemloop ID | hsa-mir-148b | ||||
| Sequence | ucagugcaucacagaacuuugu | ||||
| TTD Target(s) Regulated by This miRNA | Gastrin/cholecystokinin type B receptor (CCKBR) | Successful Target | Target Info | [1] | |
| Heat shock protein 90 alpha (HSP90A) | Successful Target | Target Info | [2] | ||
| PI3-kinase alpha (PIK3CA) | Successful Target | Target Info | [3] | ||
| Rho-associated protein kinase 1 (ROCK1) | Successful Target | Target Info | [3] | ||
| Mixed lineage kinase 1 (MAP3K9) | Clinical trial Target | Target Info | [4] | ||
| DNA [cytosine-5]-methyltransferase 1 (DNMT1) | Clinical trial Target | Target Info | [5] | ||
| DNA [cytosine-5]-methyltransferase 3B (DNMT3B) | Clinical trial Target | Target Info | [6] | ||
| Integrin alpha-5 (ITGA5) | Clinical trial Target | Target Info | [3] | ||
| GTPase NRas (NRAS) | Clinical trial Target | Target Info | [3] | ||
| Macrophage colony-stimulating factor 1 (CSF1) | Clinical trial Target | Target Info | [3] | ||
| Activin receptor-like kinase 2 (ALK-2) | Clinical trial Target | Target Info | [7] | ||
| NADPH oxidase 2 (CYBB) | Literature-reported Target | Target Info | [8] | ||
| Activated leukocyte cell adhesionmolecule (ALCAM) | Clinical trial Target | Target Info | [9] | ||
| HepG2 glucose transporter (SLC2A1) | Preclinical Target | Target Info | [10] | ||
| DNA mismatch repair protein Mlh1 (MLH1) | Literature-reported Target | Target Info | [11] | ||
| Protein(s) Regulated by This miRNA | 5'-AMP-activated protein kinase subunit beta-1 | Regulated Protein | [12] | ||
| HLA class I histocompatibility antigen, alpha chain G | Regulated Protein | [13] | |||
| Phosphatidylinositol 3-kinase regulatory subunit gamma | Regulated Protein | [14] | |||
| Proto-oncogene Wnt-1 | Regulated Protein | [15] | |||
| References | |||||
| REF 1 | Altered expression of MiR-148a and MiR-152 in gastrointestinal cancers and its clinical significance. J Gastrointest Surg. 2010 Jul;14(7):1170-9. | ||||
| REF 2 | Down-regulation of hsa-miR-148b inhibits vascular smooth muscle cells proliferation and migration by directly targeting HSP90 in atherosclerosis. Am J Transl Res. 2017 Feb 15;9(2):629-637. | ||||
| REF 3 | miR148b is a major coordinator of breast cancer progression in a relapse-associated microRNA signature by targeting ITGA5, ROCK1, PIK3CA, NRAS, and CSF1. FASEB J. 2013 Mar;27(3):1223-35. | ||||
| REF 4 | In-depth analysis of the interaction of HIV-1 with cellular microRNA biogenesis and effector mechanisms. MBio. 2013 Apr 16;4(2):e000193. | ||||
| REF 5 | MicroRNA-dependent regulation of DNA methyltransferase-1 and tumor suppressor gene expression by interleukin-6 in human malignant cholangiocytes. Hepatology. 2010 Mar;51(3):881-90. | ||||
| REF 6 | MicroRNA-29 family reverts aberrant methylation in lung cancer by targeting DNA methyltransferases 3A and 3B. Proc Natl Acad Sci U S A. 2007 Oct 2;104(40):15805-10. | ||||
| REF 7 | The role of the 3'UTR region in the regulation of the ACVR1/Alk-2 gene expression. PLoS One. 2012;7(12):e50958. | ||||
| REF 8 | High-throughput screening identifies microRNAs that target Nox2 and improve function after acute myocardial infarction. Am J Physiol Heart Circ Physiol. 2017 May 1;312(5):H1002-H1012. | ||||
| REF 9 | miR-214 coordinates melanoma progression by upregulating ALCAM through TFAP2 and miR-148b downmodulation. Cancer Res. 2013 Jul 1;73(13):4098-111. | ||||
| REF 10 | miR-148b inhibits glycolysis in gastric cancer through targeting SLC2A1. Cancer Med. 2017 Jun;6(6):1301-1310. | ||||
| REF 11 | miRNA-148b regulates radioresistance in non-small lung cancer cells via regulation of MutL homologue 1. Biosci Rep. 2016 Jun 30;36(3). pii: e00354. | ||||
| REF 12 | miR-148b functions as a tumor suppressor in pancreatic cancer by targeting AMPK1.Mol Cancer Ther. 2013 Jan;12(1):83-93. | ||||
| REF 13 | Allele-specific targeting of microRNAs to HLA-G and risk of asthma.Am J Hum Genet. 2007 Oct;81(4):829-34. | ||||
| REF 14 | Altered p53 regulation of miR-148b and p55PIK contributes to tumor progression in colorectal cancer.Oncogene. 2015 Feb 12;34(7):912-21. | ||||
| REF 15 | Restoration of BRG1 inhibits proliferation and metastasis of lung cancer by regulating tumor suppressor miR-148b.Onco Targets Ther. 2015 Dec 2;8:3603-12. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.