miRNA Details

miRNA General Information
miRNA Mature ID hsa-miR-15b-5p
miRNA Stemloop AC MI0000438
miRNA Stemloop ID hsa-mir-15b
Sequence uagcagcacaucaugguuuaca
TTD Target(s) Regulated by This miRNA Insulin receptor (INSR) Successful Target Target Info [1]
Vascular endothelial growth factor receptor 2 (KDR) Successful Target Target Info [2]
Apoptosis regulator Bcl-2 (BCL-2) Successful Target Target Info [3]
Interferon-gamma (IFNG) Successful Target Target Info [4]
Fibroblast growth factor-2 (FGF2) Successful Target Target Info [5]
Transforming growth factor beta 1 (TGFB1) Successful Target Target Info [6]
Vascular endothelial growth factor A (VEGFA) Successful Target Target Info [7]
Matrix metalloproteinase-9 (MMP-9) Clinical trial Target Target Info [8]
Checkpoint kinase-1 (CHK1) Clinical trial Target Target Info [9]
RAC-gamma serine/threonine-protein kinase (AKT3) Successful Target Target Info [10]
Wee1-like protein kinase (WEE1) Clinical trial Target Target Info [5]
G1/S-specific cyclin-D1 (CCND1) Clinical trial Target Target Info [11]
Hepatocyte nuclear factor 1-alpha (HNF1A) Clinical trial Target Target Info [12]
G1/S-specific cyclin-E1 (CCNE1) Literature-reported Target Target Info [13]
Forkhead box protein O1A (FOXO1) Literature-reported Target Target Info [14]
Polycomb complex protein BMI-1 (BMI1) Clinical trial Target Target Info [15]
Protein phosphatase 1D (PPM1D) Literature-reported Target Target Info [16]
Cyclin D (CCND3) Literature-reported Target Target Info [17]
Suppressor of cytokine signaling 3 (SOCS3) Literature-reported Target Target Info [18]
Suppressor of tumorigenicity 15 protein (ST15) Literature-reported Target Target Info [19]
Protein(s) Regulated by This miRNA Apoptosis regulator BAX Regulated Protein
BAX_HUMAN
[6]
Axin-2 Regulated Protein
AXIN2_HUMAN
[21]
Cysteine-rich motor neuron 1 protein Regulated Protein
CRIM1_HUMAN
[22]
E3 ubiquitin-protein ligase SMURF1 Regulated Protein
SMUF1_HUMAN
[22]
Eukaryotic initiation factor 4A-I Regulated Protein
IF4A1_HUMAN
[23]
Galactoside 2-alpha-L-fucosyltransferase 2 Regulated Protein
FUT2_HUMAN
[24]
Metastasis suppressor protein 1 Regulated Protein
MTSS1_HUMAN
[25]
Mothers against decapentaplegic homolog 2 Regulated Protein
SMAD2_HUMAN
[6]
Phosphatidylethanolamine-binding protein 4 Regulated Protein
PEBP4_HUMAN
[26]
Protein argonaute-2 Regulated Protein
AGO2_HUMAN
[27]
Protein Mis18-beta Regulated Protein
MS18B_HUMAN
[28]
Ras-related protein Rab-1A Regulated Protein
RAB1A_HUMAN
[29]
T-box brain protein 1 Regulated Protein
TBR1_HUMAN
[6]
Transcriptional activator protein Pur-alpha Regulated Protein
PURA_HUMAN
[30]
Tripartite motif-containing protein 14 Regulated Protein
TRI14_HUMAN
[31]
Tripartite motif-containing protein 29 Regulated Protein
TRI29_HUMAN
[32]
References
REF 1 Obesity-induced miR-15b is linked causally to the development of insulin resistance through the repression of the insulin receptor in hepatocytes. Mol Nutr Food Res. 2015 Nov;59(11):2303-14.
REF 2 MicroRNA-15b contributes to ginsenoside-Rg1-induced angiogenesis through increased expression of VEGFR-2. Biochem Pharmacol. 2013 Aug 1;86(3):392-400.
REF 3 miR-15 and miR-16 induce apoptosis by targeting BCL2. Proc Natl Acad Sci U S A. 2005 Sep 27;102(39):13944-9.
REF 4 MicroRNA-deficient NK cells exhibit decreased survival but enhanced function. J Immunol. 2012 Apr 1;188(7):3019-30.
REF 5 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
REF 6 High expression of miR-15b predicts poor prognosis for hepatocellular carcinoma after curative hepatectomy. Oncol Rep. 2016 Oct;36(4):1901-8.
REF 7 The effect of central loops in miRNA:MRE duplexes on the efficiency of miRNA-mediated gene regulation. PLoS One. 2008 Mar 5;3(3):e1719.
REF 8 Mangiferin regulates proliferation and apoptosis in glioma cells by induction of microRNA-15b and inhibition of MMP-9 expression. Oncol Rep. 2015 Jun;33(6):2815-20.
REF 9 EBV and human microRNAs co-target oncogenic and apoptotic viral and human genes during latency. EMBO J. 2012 May 2;31(9):2207-21.
REF 10 A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.
REF 11 MicroRNA-15b regulates cell cycle progression by targeting cyclins in glioma cells. Biochem Biophys Res Commun. 2009 Mar 6;380(2):205-10.
REF 12 Modulation of HBV replication by microRNA-15b through targeting hepatocyte nuclear factor 1. Nucleic Acids Res. 2014 Jun;42(10):6578-90.
REF 13 miR-16 family induces cell cycle arrest by regulating multiple cell cycle genes. Nucleic Acids Res. 2008 Sep;36(16):5391-404.
REF 14 Elucidation of transcriptome-wide microRNA binding sites in human cardiac tissues by Ago2 HITS-CLIP. Nucleic Acids Res. 2016 Sep 6;44(15):7120-31.
REF 15 Targeting of the Bmi-1 oncogene/stem cell renewal factor by microRNA-128 inhibits glioma proliferation and self-renewal. Cancer Res. 2008 Nov 15;68(22):9125-30.
REF 16 miR-15b/16-2 regulates factors that promote p53 phosphorylation and augments the DNA damage response following radiation in the lung. J Biol Chem. 2014 Sep 19;289(38):26406-16.
REF 17 Downregulation of CCND1 and CDK6 by miR-34a induces cell cycle arrest. FEBS Lett. 2008 Apr 30;582(10):1564-8.
REF 18 miR-15b/16 protects primary human retinal microvascular endothelial cells against hyperglycemia-induced increases in tumor necrosis factor alpha and suppressor of cytokine signaling 3. J Neuroinflammation. 2015 Mar 4;12:44.
REF 19 MicroRNA 21 promotes glioma invasion by targeting matrix metalloproteinase regulators. Mol Cell Biol. 2008 Sep;28(17):5369-80.
REF 20 High expression of miR-15b predicts poor prognosis for hepatocellular carcinoma after curative hepatectomy. Oncol Rep. 2016 Oct;36(4):1901-8.
REF 21 MicroRNAs modulate the Wnt signaling pathway through targeting its inhibitors.Biochem Biophys Res Commun. 2011 May 6;408(2):259-64.
REF 22 A positive role of microRNA-15b on regulation of osteoblast differentiation.J Cell Physiol. 2014 Sep;229(9):1236-44.
REF 23 Differentially regulated micro-RNAs and actively translated messenger RNA transcripts by tumor suppressor p53 in colon cancer.Clin Cancer Res. 2006 Apr 1;12(7 Pt 1):2014-24.
REF 24 Downregulation of microRNA-15b by hepatitis B virus X enhances hepatocellular carcinoma proliferation via fucosyltransferase 2-induced Globo H expression.Int J Cancer. 2014 Apr 1;134(7):1638-47.
REF 25 EGF induces microRNAs that target suppressors of cell migration: miR-15b targets MTSS1 in breast cancer.Sci Signal. 2015 Mar 17;8(368):ra29.
REF 26 miR-15b regulates cisplatin resistance and metastasis by targeting PEBP4 in human lung adenocarcinoma cells.Cancer Gene Ther. 2015 Apr;22(3):108-14.
REF 27 miR-15b-AGO2 play a critical role in HTR8/SVneo invasion and in a model of angiogenesis defects related to inflammation.Placenta. 2016 May;41:62-73.
REF 28 OIP5, a target of miR-15b-5p, regulates hepatocellular carcinoma growth and metastasis through the AKT/mTORC1 and -catenin signaling pathways.Oncotarget. 2017 Mar 14;8(11):18129-18144.
REF 29 miR-15b-5p induces endoplasmic reticulum stress and apoptosis in human hepatocellular carcinoma, both in vitro and in vivo, by suppressing Rab1A.Oncotarget. 2015 Jun 30;6(18):16227-38.
REF 30 Translation of Pur- is targeted by cellular miRNAs to modulate the differentiation-dependent susceptibility of monocytes to HIV-1 infection.FASEB J. 2012 Nov;26(11):4755-64.
REF 31 miR-15b inhibits cancer-initiating cell phenotypes and chemoresistance of cisplatin by targeting TRIM14 in oral tongue squamous cell cancer.Oncol Rep. 2017 May;37(5):2720-2726.
REF 32 Upregulated TRIM29 promotes proliferation and metastasis of nasopharyngeal carcinoma via PTEN/AKT/mTOR signal pathway.Oncotarget. 2016 Mar 22;7(12):13634-50.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.