miRNA Details

miRNA General Information
miRNA Mature ID hsa-miR-214-3p
miRNA Stemloop AC MI0000290
miRNA Stemloop ID hsa-mir-214
Sequence acagcaggcacagacaggcagu
TTD Target(s) Regulated by This miRNA Fibroblast growth factor receptor 1 (FGFR1) Successful Target Target Info [1]
Cyclin-dependent kinase 6 (CDK6) Successful Target Target Info [2]
Programmed cell death 1 ligand 1 (PD-L1) Successful Target Target Info [3]
Beta-catenin (CTNNB1) Successful Target Target Info [4]
Extracellular signal-regulated kinase 2 (ERK2) Clinical trial Target Target Info [5]
Stress-activated protein kinase 2a (p38 alpha) Clinical trial Target Target Info [5]
Stress-activated protein kinase JNK1 (JNK1) Clinical trial Target Target Info [6]
Apoptosis inhibitor survivin (BIRC5) Clinical trial Target Target Info [7]
Apoptosis regulator Bcl-W (BCL-W) Clinical trial Target Target Info [8]
Cellular tumor antigen p53 (TP53) Clinical trial Target Target Info [9]
Enhancer of zeste homolog 2 (EZH2) Successful Target Target Info [10]
Serine/threonine-protein kinase pim-1 (PIM1) Clinical trial Target Target Info [11]
GTPase NRas (NRAS) Clinical trial Target Target Info [12]
Lactotransferrin (LTF) Clinical trial Target Target Info [13]
Mitochondrial matrix protein P1 (HSPD1) Clinical trial Target Target Info [6]
Semaphorin-4D (SEMA4D) Clinical trial Target Target Info [14]
T-cell-specific protein RANTES (CCL5) Clinical trial Target Target Info [15]
Glutathione reductase (GR) Patented-recorded Target Target Info [16]
Cytochrome P450 reductase (P450) Discontinued Target Target Info [16]
ERK activator kinase 5 (MAP2K5) Literature-reported Target Target Info [6]
Phosphatase and tensin homolog (PTEN) Literature-reported Target Target Info [17]
Activating transcription factor 4 (ATF-4) Literature-reported Target Target Info [18]
ADP-ribosylation factor-like protein 2 (ARL2) Literature-reported Target Target Info [6]
Gankyrin (PSMD10) Literature-reported Target Target Info [19]
GTPase activating protein (RASA1) Literature-reported Target Target Info [6]
Hepatoma-derived growth factor (HDGF) Literature-reported Target Target Info [20]
Protein(s) Regulated by This miRNA Actin-binding LIM protein 3 Regulated Protein
ABLM3_HUMAN
[11]
Alpha-protein kinase 2 Regulated Protein
ALPK2_HUMAN
[22]
Apoptosis regulator BAX Regulated Protein
BAX_HUMAN
[23]
Bcl-2-like protein 11 Regulated Protein
B2L11_HUMAN
[24]
Calpain-5 Regulated Protein
CAN5_HUMAN
[11]
Carboxypeptidase D Regulated Protein
CBPD_HUMAN
[25]
Cell adhesion molecule 1 Regulated Protein
CADM1_HUMAN
[26]
Cytoplasmic polyadenylation element-binding protein 4 Regulated Protein
CPEB4_HUMAN
[11]
Death-associated protein kinase 1 Regulated Protein
DAPK1_HUMAN
[27]
Dedicator of cytokinesis protein 9 Regulated Protein
DOCK9_HUMAN
[11]
Dual specificity mitogen-activated protein kinase kinase 3 Regulated Protein
MP2K3_HUMAN
[6]
Histone chaperone ASF1B Regulated Protein
ASF1B_HUMAN
[19]
Inhibitor of growth protein 4 Regulated Protein
ING4_HUMAN
[30]
Kinesin-like protein KIF1B Regulated Protein
KIF1B_HUMAN
[11]
Leucine zipper putative tumor suppressor 1 Regulated Protein
LZTS1_HUMAN
[31]
Myocyte-specific enhancer factor 2C Regulated Protein
MEF2C_HUMAN
[32]
N-acetylgalactosaminyltransferase 7 Regulated Protein
GALT7_HUMAN
[33]
Pappalysin-1 Regulated Protein
PAPP1_HUMAN
[22]
Plexin-B1 Regulated Protein
PLXB1_HUMAN
[34]
POU domain, class 4, transcription factor 2 Regulated Protein
PO4F2_HUMAN
[35]
Protein jagged-1 Regulated Protein
JAG1_HUMAN
[36]
Protein quaking Regulated Protein
QKI_HUMAN
[37]
Ras-related protein Rab-15 Regulated Protein
RAB15_HUMAN
[38]
Ras-related protein Rab-5B Regulated Protein
RAB5B_HUMAN
[11]
Rho GTPase-activating protein 10 Regulated Protein
RHG10_HUMAN
[11]
SLIT-ROBO Rho GTPase-activating protein 1 Regulated Protein
SRGP1_HUMAN
[39]
SLIT-ROBO Rho GTPase-activating protein 2 Regulated Protein
SRGP2_HUMAN
[39]
SUMO-conjugating enzyme UBC9 Regulated Protein
UBC9_HUMAN
[40]
Suppressor of fused homolog Regulated Protein
SUFU_HUMAN
[41]
Twinfilin-1 Regulated Protein
TWF1_HUMAN
[11]
Twist-related protein 1 Regulated Protein
TWST1_HUMAN
[42]
X-box-binding protein 1 Regulated Protein
XBP1_HUMAN
[43]
Zinc finger transcription factor Trps1 Regulated Protein
TRPS1_HUMAN
[11]
References
REF 1 Downregulation of microRNA-214 and overexpression of FGFR-1 contribute to hepatocellular carcinoma metastasis. Biochem Biophys Res Commun. 2013 Sep 13;439(1):47-53.
REF 2 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
REF 3 Identifying microRNAs regulating B7-H3 in breast cancer: the clinical impact of microRNA-29c. Br J Cancer. 2014 Apr 15;110(8):2072-80.
REF 4 MiR-214 targets -catenin pathway to suppress invasion, stem-like traits and recurrence of human hepatocellular carcinoma. PLoS One. 2012;7(9):e44206.
REF 5 miRNA-214 modulates radiotherapy response of non-small cell lung cancer cells through regulation of p38MAPK, apoptosis and senescence. Br J Cancer. 2012 Oct 9;107(8):1361-73.
REF 6 MicroRNA-214 is aberrantly expressed in cervical cancers and inhibits the growth of HeLa cells. IUBMB Life. 2009 Nov;61(11):1075-82.
REF 7 Induction of growth arrest by miR-542-3p that targets survivin. FEBS Lett. 2010 Sep 24;584(18):4048-52.
REF 8 MiR-214 reduces cell survival and enhances cisplatin-induced cytotoxicity via down-regulation of Bcl2l2 in cervical cancer cells. FEBS Lett. 2013 Mar 1;587(5):488-95.
REF 9 miR-605 joins p53 network to form a p53:miR-605:Mdm2 positive feedback loop in response to stress. EMBO J. 2011 Feb 2;30(3):524-32.
REF 10 Mir-214-dependent regulation of the polycomb protein Ezh2 in skeletal muscle and embryonic stem cells. Mol Cell. 2009 Oct 9;36(1):61-74.
REF 11 MicroRNA profiling in mucosal biopsies of eosinophilic esophagitis patients pre and post treatment with steroids and relationship with mRNA targets. PLoS One. 2012;7(7):e40676.
REF 12 MiR-214 and N-ras regulatory loop suppresses rhabdomyosarcoma cell growth and xenograft tumorigenesis. Oncotarget. 2014 Apr 30;5(8):2161-75.
REF 13 miR-214 promotes tumorigenesis by targeting lactotransferrin in nasopharyngeal carcinoma. Tumour Biol. 2013 Jun;34(3):1793-800.
REF 14 MiR-214 suppressed ovarian cancer and negatively regulated semaphorin 4D. Tumour Biol. 2016 Jun;37(6):8239-48.
REF 15 MicroRNAs reprogram normal fibroblasts into cancer-associated fibroblasts in ovarian cancer. Cancer Discov. 2012 Dec;2(12):1100-8.
REF 16 MiR-214 promotes the alcohol-induced oxidative stress via down-regulation of glutathione reductase and cytochrome P450 oxidoreductase in liver cells. Alcohol Clin Exp Res. 2014 Jan;38(1):68-77.
REF 17 Prediction of mammalian microRNA targets. Cell. 2003 Dec 26;115(7):787-98.
REF 18 miR-214 targets ATF4 to inhibit bone formation. Nat Med. 2013 Jan;19(1):93-100.
REF 19 Restoration of microRNA-214 expression reduces growth of myeloma cells through positive regulation of P53 and inhibition of DNA replication. Haematologica. 2013 Apr;98(4):640-8.
REF 20 MicroRNA-214 downregulation contributes to tumor angiogenesis by inducing secretion of the hepatoma-derived growth factor in human hepatoma. J Hepatol. 2012 Sep;57(3):584-91.
REF 21 MicroRNA profiling in mucosal biopsies of eosinophilic esophagitis patients pre and post treatment with steroids and relationship with mRNA targets. PLoS One. 2012;7(7):e40676.
REF 22 miRNA-214 is related to invasiveness of human non-small cell lung cancer and directly regulates alpha protein kinase 2 expression. Genes Chromosomes Cancer. 2013 Oct;52(10):895-911.
REF 23 Isoflurane increases neuronal cell death vulnerability by downregulating miR-214.PLoS One. 2013;8(2):e55276.
REF 24 Knockdown of miR-214 promotes apoptosis and inhibits cell proliferation in nasopharyngeal carcinoma.PLoS One. 2014 Jan 21;9(1):e86149.
REF 25 microRNA-214 Governs Lung Cancer Growth and Metastasis by Targeting Carboxypeptidase-D. DNA Cell Biol. 2016 Nov;35(11):715-721.
REF 26 miR-214 and hypoxia down-regulate Necl-2/CADM1 and enhance ErbB2/ErbB3 signaling.Genes Cells. 2013 Mar;18(3):195-202.
REF 27 MicroRNA expression profiles in umbilical cord blood cell lineages. Stem Cells Dev. 2010 Jan;19(1):17-26.
REF 28 MicroRNA-214 is aberrantly expressed in cervical cancers and inhibits the growth of HeLa cells. IUBMB Life. 2009 Nov;61(11):1075-82.
REF 29 Restoration of microRNA-214 expression reduces growth of myeloma cells through positive regulation of P53 and inhibition of DNA replication. Haematologica. 2013 Apr;98(4):640-8.
REF 30 Dysregulation of miR-15a and miR-214 in human pancreatic cancer. J Hematol Oncol. 2010 Nov 24;3:46.
REF 31 miR-214 promotes the proliferation and invasion of osteosarcoma cells through direct suppression of LZTS1.Biochem Biophys Res Commun. 2014 Jun 27;449(2):190-5.
REF 32 Myocyte-specific enhancer factor 2C: a novel target gene of miR-214-3p in suppressing angiotensin II-induced cardiomyocyte hypertrophy.Sci Rep. 2016 Oct 31;6:36146.
REF 33 MicroRNA-214 suppresses growth and invasiveness of cervical cancer cells by targeting UDP-N-acetyl--D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7.J Biol Chem. 2012 Apr 20;287(17):14301-9.
REF 34 Plexin-B1 is a target of miR-214 in cervical cancer and promotes the growth and invasion of HeLa cells.Int J Biochem Cell Biol. 2011 Apr;43(4):632-41.
REF 35 Cell-specific regulation of the pro-survival Brn-3b transcription factor by microRNAs.Mol Cell Neurosci. 2010 Dec;45(4):317-23.
REF 36 Modeling SNP mediated differential targeting of homologous 3'UTR by microRNA. RNA Biol. 2012 Mar;9(3):351-60.
REF 37 MicroRNA-214 inhibits angiogenesis by targeting Quaking and reducing angiogenic growth factor release.Cardiovasc Res. 2012 Mar 15;93(4):655-65.
REF 38 ADAR2-mediated editing of miR-214 and miR-122 precursor and antisense RNA transcripts in liver cancers.PLoS One. 2013 Dec 27;8(12):e81922.
REF 39 MicroRNAs 144, 145, and 214 are down-regulated in primary neurons responding to sciatic nerve transection.Brain Res. 2011 Apr 6;1383:62-70.
REF 40 microRNA-214-mediated UBC9 expression in glioma. BMB Rep. 2012 Nov;45(11):641-6.
REF 41 microRNA-214 promotes epithelial-mesenchymal transition and metastasis in lung adenocarcinoma by targeting the suppressor-of-fused protein (Sufu).Oncotarget. 2015 Nov 17;6(36):38705-18.
REF 42 Down-regulation of miR-214 contributes to intrahepatic cholangiocarcinoma metastasis by targeting Twist.FEBS J. 2012 Jul;279(13):2393-8.
REF 43 ER stress negatively modulates the expression of the miR-199a/214 cluster to regulates tumor survival and progression in human hepatocellular cancer.PLoS One. 2012;7(2):e31518.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.