miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-302a-3p | ||||
| miRNA Stemloop AC | MI0000738 | ||||
| miRNA Stemloop ID | hsa-mir-302a | ||||
| Sequence | uaagugcuuccauguuuugguga | ||||
| TTD Target(s) Regulated by This miRNA | Cyclin-dependent kinase 4 (CDK4) | Successful Target | Target Info | [1] | |
| ATP-binding cassette transporter A1 (ABCA1) | Successful Target | Target Info | [2] | ||
| RAC-alpha serine/threonine-protein kinase (AKT1) | Successful Target | Target Info | [3] | ||
| Cyclin-dependent kinase 1 (CDK1) | Clinical trial Target | Target Info | [4] | ||
| Cyclin-dependent kinase 2 (CDK2) | Clinical trial Target | Target Info | [5] | ||
| G1/S-specific cyclin-D1 (CCND1) | Clinical trial Target | Target Info | [6] | ||
| MAPK/ERK kinase kinase 1 (MAP3K1) | Clinical trial Target | Target Info | [7] | ||
| Syndecan-1 (SDC1) | Clinical trial Target | Target Info | [8] | ||
| Phosphatase and tensin homolog (PTEN) | Literature-reported Target | Target Info | [9] | ||
| Polycomb complex protein BMI-1 (BMI1) | Clinical trial Target | Target Info | [5] | ||
| Melanoma differentiation-associated protein 6 (CDKN1A) | Literature-reported Target | Target Info | [10] | ||
| Protein(s) Regulated by This miRNA | COUP transcription factor 2 | Regulated Protein | [11] | ||
| DAZ-associated protein 2 | Regulated Protein | [12] | |||
| GRB2-associated-binding protein 2 | Regulated Protein | [13] | |||
| Homeobox protein NANOG | Regulated Protein | [14] | |||
| Left-right determination factor 1 | Regulated Protein | [15] | |||
| Left-right determination factor 2 | Regulated Protein | [15] | |||
| Methyl-CpG-binding domain protein 2 | Regulated Protein | [14] | |||
| Protachykinin-1 | Regulated Protein | [16] | |||
| Protein Tob2 | Regulated Protein | [12] | |||
| SLAIN motif-containing protein 1 | Regulated Protein | [12] | |||
| References | |||||
| REF 1 | Oct4/Sox2-regulated miR-302 targets cyclin D1 in human embryonic stem cells. Mol Cell Biol. 2008 Oct;28(20):6426-38. | ||||
| REF 2 | MicroRNA 302a is a novel modulator of cholesterol homeostasis and atherosclerosis. Arterioscler Thromb Vasc Biol. 2015 Feb;35(2):323-31. | ||||
| REF 3 | The microRNA-302-367 cluster suppresses the proliferation of cervical carcinoma cells through the novel target AKT1. RNA. 2013 Jan;19(1):85-95. | ||||
| REF 4 | MicroRNA miR-302 inhibits the tumorigenicity of endometrial cancer cells by suppression of Cyclin D1 and CDK1. Cancer Lett. 2014 Apr 1;345(1):39-47. | ||||
| REF 5 | Inhibitors of enhancer of zeste homolog 2 (EZH2) activate tumor-suppressor microRNAs in human cancer cells. Oncogenesis. 2014 May 26;3:e104. | ||||
| REF 6 | MicroRNA let-7b targets important cell cycle molecules in malignant melanoma cells and interferes with anchorage-independent growth. Cell Res. 2008 May;18(5):549-57. | ||||
| REF 7 | MiR-302a/b/c/d cooperatively sensitizes breast cancer cells to adriamycin via suppressing P-glycoprotein(P-gp) by targeting MAP/ERK kinase kinase 1 (MEKK1). J Exp Clin Cancer Res. 2016 Feb 3;35:25. | ||||
| REF 8 | MiR-302a inhibits the tumorigenicity of ovarian cancer cells by suppression of SDC1. Int J Clin Exp Pathol. 2015 May 1;8(5):4869-80. | ||||
| REF 9 | miR-302 Attenuates Amyloid--Induced Neurotoxicity through Activation of Akt Signaling. J Alzheimers Dis. 2016;50(4):1083-98. | ||||
| REF 10 | Multiple microRNAs rescue from Ras-induced senescence by inhibiting p21(Waf1/Cip1). Oncogene. 2010 Apr 15;29(15):2262-71. | ||||
| REF 11 | A regulatory circuitry comprised of miR-302 and the transcription factors OCT4 and NR2F2 regulates human embryonic stem cell differentiation.EMBO J. 2011 Jan 19;30(2):237-48. | ||||
| REF 12 | Genome-wide identification of microRNA targets in human ES cells reveals a role for miR-302 in modulating BMP response.Genes Dev. 2011 Oct 15;25(20):2173-86. | ||||
| REF 13 | MicroRNA-302a targets GAB2 to suppress cell proliferation, migration and invasion of glioma.Oncol Rep. 2017 Feb;37(2):1159-1167. | ||||
| REF 14 | Epigenetic regulation of NANOG by miR-302 cluster-MBD2 completes induced pluripotent stem cell reprogramming.Stem Cells. 2013 Apr;31(4):666-81. | ||||
| REF 15 | The Nodal inhibitor Lefty is negatively modulated by the microRNA miR-302 in human embryonic stem cells.FASEB J. 2011 May;25(5):1497-508. | ||||
| REF 16 | MicroRNAs regulate synthesis of the neurotransmitter substance P in human mesenchymal stem cell-derived neuronal cells.Proc Natl Acad Sci U S A. 2007 Sep 25;104(39):15484-9. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.