miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-433-3p | ||||
| miRNA Stemloop AC | MI0001723 | ||||
| miRNA Stemloop ID | hsa-mir-433 | ||||
| Sequence | aucaugaugggcuccucggugu | ||||
| TTD Target(s) Regulated by This miRNA | Proto-oncogene c-Met (MET) | Successful Target | Target Info | [1] | |
| cAMP-dependent chloride channel (CFTR) | Successful Target | Target Info | [2] | ||
| Histone deacetylase 6 (HDAC6) | Clinical trial Target | Target Info | [3] | ||
| Hypoxia-inducible factor 1 alpha (HIF-1A) | Clinical trial Target | Target Info | [4] | ||
| Thymidylate synthase (TYMS) | Clinical trial Target | Target Info | [5] | ||
| Cyclic AMP-responsive element-binding protein (CREB1) | Literature-reported Target | Target Info | [1] | ||
| Runt-related transcription factor 2 (RUNX2) | Literature-reported Target | Target Info | [6] | ||
| Protein(s) Regulated by This miRNA | Antizyme inhibitor 1 | Regulated Protein | [7] | ||
| Fibroblast growth factor 20 | Regulated Protein | [8] | |||
| Guanylate-binding protein 2 | Regulated Protein | [9] | |||
| References | |||||
| REF 1 | c-Met and CREB1 are involved in miR-433-mediated inhibition of the epithelial-mesenchymal transition in bladder cancer by regulating Akt/GSK-3/Snail signaling. Cell Death Dis. 2016 Feb 4;7:e2088. | ||||
| REF 2 | Gene mutation in microRNA target sites of CFTR gene: a novel pathogenetic mechanism in cystic fibrosis PLoS One. 2013;8(3):e60448. | ||||
| REF 3 | A mutation in the 3'-UTR of the HDAC6 gene abolishing the post-transcriptional regulation mediated by hsa-miR-433 is linked to a new form of dominant X-linked chondrodysplasia. Hum Mol Genet. 2010 May 15;19(10):2015-27. | ||||
| REF 4 | MicroRNA-433 Inhibits the Proliferation and Migration of HUVECs and Neurons by Targeting Hypoxia-Inducible Factor 1 Alpha. J Mol Neurosci. 2017 Feb;61(2):135-143. | ||||
| REF 5 | MicroRNA-433 negatively regulates the expression of thymidylate synthase (TYMS) responsible for 5-fluorouracil sensitivity in HeLa cells. BMC Cancer. 2013 Aug 2;13:369. | ||||
| REF 6 | MiR-433 mediates ERR-suppressed osteoblast differentiation via direct targeting to Runx2 mRNA in C3H10T1/2 cells. Life Sci. 2013 Mar 21;92(10):562-8. | ||||
| REF 7 | The microRNA miR-433 promotes renal fibrosis by amplifying the TGF-/Smad3-Azin1 pathway.Kidney Int. 2013 Dec;84(6):1129-44. | ||||
| REF 8 | Variation in the miRNA-433 binding site of FGF20 confers risk for Parkinson disease by overexpression of alpha-synuclein.Am J Hum Genet. 2008 Feb;82(2):283-9. | ||||
| REF 9 | miR-433 is aberrantly expressed in myeloproliferative neoplasms and suppresses hematopoietic cell growth and differentiation.Leukemia. 2013 Feb;27(2):344-52. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.